PDA

View Full Version : Alternative to creationism & intellegent Design


Pages : [1] 2 3

figure2
July 27th, 2005, 10:22 PM
I dare the Creationists to prove this wrong: :tihi:
http://www.venganza.org/index.htm

MoP
July 27th, 2005, 10:34 PM
Ahahaha, excellent read!

I may just convert to the church of the Flying Spaghetti Monster myself.

All praise His Noodly Appendage! :D

Elwell
July 27th, 2005, 10:37 PM
I love you

stoph
July 27th, 2005, 10:50 PM
this means what, exactly? hes taking a dig at Creationists, using a naive C-14 argument and a cynical approach to Scripture. thats all. whats to debunk?

brokk
July 27th, 2005, 11:05 PM
http://img.photobucket.com/albums/v254/bk7600/Iwanttobelieve.jpg

S.C. Watson
July 27th, 2005, 11:16 PM
Loved it :teeth: I hope they really did send it.

Cyrus
July 27th, 2005, 11:23 PM
1. Makes up random hypothesis that sounds kinda like evolution but isn't really at all.

2. Hypothesis in question doesn't make any sense at all.

3. Laughs at hypothesis and concludes that evolution must be dumb as well.

;)

brokk
July 27th, 2005, 11:48 PM
Oh man... I have found my signature at last...

EDIT:He's arguing that a science classroom is not the place to teach non-scientific theories. He's not even against creationism being taught in school, its just that a science classroom is not the appropiate place for it. Read the FAQ: http://www.venganza.org/faq.htm

SJ Bennighof
July 28th, 2005, 01:25 AM
this means what, exactly? hes taking a dig at Creationists, using a naive C-14 argument and a cynical approach to Scripture. thats all. whats to debunk?

'stoph, I love ya man, but a warning: this never goes well, and this is now the fourth thread of its kind. You'd be better off drawing.

JERI
July 28th, 2005, 04:58 AM
(tears of laughter)

NoSeRider
July 28th, 2005, 05:19 AM
http://www.templeton.org/grant_opportunities/index.asp

There are religous people that believe in evolution, but believe that evolution is by God's design......and they're willing to give grants for you to prove it too.

So now religion seems to be succumbing to science.

stoph
July 28th, 2005, 08:30 AM
thanks, SJ, youre right (i love you too, by the way ;) hehe). i will make one small note of clarification, then leave it at that.


There are religous people that believe in evolution, but believe that evolution is by God's design......and they're willing to give grants for you to prove it too.

So now religion seems to be succumbing to science.

youre right (to an extent). there are such people that claim Christendom and yet still believe in evolutionary models. personally, i call it compromise, and dont care if i offend any in such a position, because you'll note that Genesis doesnt read:

'and God (in His infinite wisdom and power) said "let there be a big bang, and have 15 billion years pass before man arrives as the growth on a monkeys back" and it was so. and God looked up from his xbox many millenia after saying this and saw that it was good'.

such compromise doesnt imply Christianity "succumbing to science", to quote you. at the moment there is a large uprising in the Creationist ranks, what with more and more Creationist materials being taken up by the church, encouraging the believers to do away with the secular theories that rob God of the credit thats due and to take on Biblical literallism (as it has always been intended to be).

let that be the end of that. :)

SJ Bennighof
July 28th, 2005, 09:13 AM
you'll note that Genesis doesnt read:

'and God (in His infinite wisdom and power) said "let there be a big bang, and have 15 billion years pass before man arrives as the growth on a monkeys back" and it was so. and God looked up from his xbox many millenia after saying this and saw that it was good'.

That's because God has a Gamecube. Duh. :rolleyes:

light
July 28th, 2005, 09:35 AM
Best... Read... Ever...

SteveO
July 28th, 2005, 09:39 AM
That's because God has a Gamecube.

Wouldn't a Phantom be more appropriate?

SJ Bennighof
July 28th, 2005, 09:46 AM
Wouldn't a Phantom be more appropriate?

Hm, I suppose so. :)

Hamsta
July 28th, 2005, 09:48 AM
Please, I must know, what does a full pirate regalia inculde?

look
July 28th, 2005, 09:53 AM
That man's nuts. He must've smoked too much sauce. >:{

Sushi is the true God!!!
His army of samurais and ninjas are undeafetable!!! And we have more solid evidence to prove all that. For those who does not believe in this thoery, rush into the nearest comic store and get your own very copy of Blade of the Immortal, or simply tune into Cartoon Network for Samurai Champloo. The wonders of believing in the Sushi God shall bring tears to your eyes.

:confident

Elwell
July 28th, 2005, 10:26 AM
Please, I must know, what does a full pirate regalia inculde?
http://altura.speedera.net/ccimg.catalogcity.com/210000/213200/213218/Products/6326282.jpg
http://sf2000.registeredsite.com/~user990875/miva/graphics/00000001/Costumes-PiratePets-TN.jpg

Ssenkrah Semaj
July 28th, 2005, 10:59 AM
I have a question for all of you who believe in creationism....Which creation story is it that you believe in..???

SJ Bennighof
July 28th, 2005, 11:09 AM
The story so far: In the beginning the Universe was created.
This has made a lot of people very angry and has been widely regarded as a bad move.
Many races believe that it was created by some sort of god, though the Jatravartid people of Viltvoodle VI believe that the entire Universe was in fact sneezed out of the nose of a being called the Great Green Arkleseizure.
The Jatravartids, who live in perpetual fear of the time they call The Coming of the Great White Handkerchief, are small blue creatures with more than fifty arms each, who are therefore unique in being the only race in history to have invented aerosol deodorant before the wheel.
:shrug:

dogfood
July 28th, 2005, 11:18 AM
I have these visions of "his noodley appendages" slipping in and cranking over the toaster dial, burning my toast, or slipping one of the cookies off my plate, or flipping off the cop at the light. <I need a "wiping tears from eyes" emoticon, Ponti>

Oh, do not engage His wrath!

Do not stand against His devious goodness!

Do not keep thy fellows from full pirate regalia!

Do not start another creationism v. evolution thread!

NoSeRider
July 28th, 2005, 11:19 AM
I don't get why creationism and evolution are contrary to one another?.....it's still creating.

To say 'God' didn't do one but did the other is kinda absurd to me.

I think it has more to do with ego. It's kinda like saying the stork brought you here, then people say you were birthed....then you're in turmoil about which way had more dignity?

SJ Bennighof
July 28th, 2005, 11:23 AM
Do not start another creationism v. evolution thread!

Yeah, or this guy will start dancing around in a loincloth waving a blood-soaked TI.

(Actually, I won't really say the last one ended all that badly. But I certainly could have been drawing some Loomis or something instead)

Ssenkrah Semaj
July 28th, 2005, 11:28 AM
The problem with the whole creation argument is that those who believe in it don't know which one they believe in, the book of Genesis contradicts its very self on what happened.

Gen.1:25
And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
Gen.1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.

Gen.2:18 And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him.
Gen.2:19 And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof.

Intelligent design? Hilarious! ...How about a book that doesn't contradict itself within the very first chapter!

jermainevl
July 28th, 2005, 11:31 AM
Sounds pretty convincing to me :shrug:

SJ Bennighof
July 28th, 2005, 11:37 AM
The problem with the whole creation argument is that those who believe in it don't know which one they believe in, the book of Genesis contradicts its very self on what happened.

Gen.1:25
And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
Gen.1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.

Gen.2:18 And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him.
Gen.2:19 And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof.

Intelligent design? Hilarious! ...How about a book that doesn't contradict itself within the very first chapter!

I wasn't going to answer this, but...I don't even follow what you're saying. Where's the contradiction?

Ssenkrah Semaj
July 28th, 2005, 11:42 AM
Well one says man was made before beast and the other says man was created after....which creation story do you believe in?

light
July 28th, 2005, 11:45 AM
Turn this into a serious discussion and so help me god (no pun intended) ill strike you where you stand.

Ssenkrah Semaj
July 28th, 2005, 11:50 AM
Turn this into a serious discussion and so help me god (no pun intended) ill strike you where you stand.

lol ...i can't resist...sj benninghof always bites too ..luv him for it. Hoping to lure Stoph in and then spring my trap!

Elwell
July 28th, 2005, 11:55 AM
I pray to the Flying Spaghetti Monster to save us from this thread.

dogfood
July 28th, 2005, 11:56 AM
I guess it would be fun if it weren't so tiring and frustrating (like pleasuring oneself to Readers Digest).

S.C. Watson
July 28th, 2005, 12:58 PM
All we need now is LaPalida to show up with the evolution links schmogusborg :P

Though it is kind of fun to sit back and watch the youngin's play :grandpa:

PHATandy
July 28th, 2005, 01:38 PM
Tht was quite amusing...

You may be interested to know that global warming, earthquakes, hurricanes, and other natural disasters are a direct effect of the shrinking numbers of Pirates since the 1800s.

jetpack42
July 28th, 2005, 01:47 PM
You know what pisses me off?

These threads are always started by somebody believing in Evolution going on the attack. The mob jumps in and starts ripping on everyone who believes in God, because that's the one unnacceptable thing to do on this forum. These same "generally" left-minded people who are so "tolerant" of all people's everywhere; except Christians.

Look, get pissed if you want at Bush for misusing religion, and even discuss the merits of the issue at hand if you want. But quit ganging up on, and ridiculing people's beliefs because you disagree with them.

Get back to work, hypocritical assholes.

ExilE
July 28th, 2005, 01:53 PM
You know what pisses me off?

These threads are always started by somebody believing in Evolution going on the attack. The mob jumps in and starts ripping on everyone who believes in God, because that's the one unnacceptable thing to do on this forum. These same "generally" left-minded people who are so "tolerant" of all people's everywhere; except Christians.

Look, get pissed if you want at Bush for misusing religion, and even discuss the merits of the issue at hand if you want. But quit ganging up on, and ridiculing people's beliefs because you disagree with them.

Get back to work, hypocritical assholes.

Couldn't have said any better jetpack.

WindWalker
July 28th, 2005, 02:29 PM
Urg...I hate these discussions.

Well one says man was made before beast and the other says man was created after....which creation story do you believe in?

I believe most of Genesis Chapter 2 is basically a summary of what had taken place in the first chapter. I don't really think it's saying Man was created first. In the Hebrew text, there are no chronological markings throughout that part of Ch. 2, much unlike Ch. 1.

Just my $0.02, anyways.

dogfood
July 28th, 2005, 02:50 PM
Urg...I hate these discussions.
All evidence to the contrary.

WindWalker
July 28th, 2005, 03:28 PM
All evidence to the contrary.
Point well taken. ;)

EDIT: Ah, and in response to the actual topic: Hehe! To paraphrase Agrippa, "Almost thou persuadest me to beocome a Spaghettite." :teeth:

CaptainInsano
July 28th, 2005, 03:34 PM
These threads always end up
Stoph vs. Semaj

Though, I agree with evolution... *ducks*

Mr. Visions
July 28th, 2005, 04:30 PM
I very well agree with Stoph and Jetpack. One question I have is doesn't God have the right to create the way He wants to? To anyone ridiculing His process of creating man, you need to go back to your sketchbook. God, being the best artist ever, created freakin' man, and if he wanted to put freakin' lasers on their heads, He could've done it, because He's....oh yeah, GOD. The Bible doesn't contradict itself at all, especially in the example given earlier. The Bible teaches one creation story, and that's the one I believe. If the Bible says He created life in six days, then He did. I hope God, being a all powerful being and worthy of worship, could have created the world in 6 days. If He couldn't, He wouldn't be God. Before handing out so called contradictions, read and try to understand what the scripture says.
I believe in all we'll never will fully grasp what happened at creation because it's like admiring another artist's piece. We don't know what the artist was thinking the entire time, what he or she was eating, whether they where cold or hot, what their day was like, what they went through in life, and every other factor that influences the origin of a concept. But we admire what we know of the process and the final product. Same with creation. We have been left what He felt has necessary, enough to let us know he loved us so much that even though He knew that not all of us would understand or believe in Him, or respect Him, He created us anyway.
It seems alright to be anything and everything besides Christian these days. I'm not saying its unexpected, but it's just old (the ridicule). If someone is misrepresenting the Christian faith, then it is they being corrupt, not the faith. It's the faith that has survived thousands upon thousands of years, seeing empires rise and fall, and yet remaining.
You can argue what I have said all you want, and if I made a mistake in wording or whatever, it's because I'm human. But the word of God, one who is perfect, is perfect and true. That's what I'm sticking with. Everyone is entitled to their beliefs, and so am I. I have read yours, and now you have mine.

God bless.

- Visions

Cthogua
July 28th, 2005, 04:51 PM
wheee...I want in :blahblah: :blahblah:

Mr. Visions: Why do you think the bible is ment to be taken literally? Even if it was, through all its various mutations and translations, guided by god so that no one could add their personal bias to it...Why would god be so literal? A being powerful enough to manifest an entire universe as an expression of its will seems (to me atleast) to be a bit beyond our ability to transcribe literal meanings from. I don't want you to think I'm attacking you or your beliefs, I would just like to discuss it.

SJ Bennighof
July 28th, 2005, 05:03 PM
Well one says man was made before beast and the other says man was created after....which creation story do you believe in?

The one where God creates beast, then Adam, and then the help-mate, Eve. Like the guy said, it was a summary. And it doesn't talk about creating the beast in the second thing you quoted. They were talking about summoning the beast from the ground, or the sky, or the water, so Adam could name them.

And please, man, there are guys who have PhDs in this stuff. It may or may not be true, but it's not going to have holes as obvious as that. And I bite, as you say, because these bits you bring up are so easily and quickly resolved. Cheers.

EDIT: By the way, I fold, whether my logic in this post holds up or not, since I just don't have time for this kind of thing. And thanks for your statement, jetpack.

Gnosis
July 28th, 2005, 05:17 PM
Who created God, Mr. Visions?
And how can you be sure that the Bible really represents the word of the creator of this universe? What makes you so sure that the Bible isn't really the word of the devil trying to lure you over to his side?

Mr. Visions
July 28th, 2005, 05:23 PM
wheee...I want in :blahblah: :blahblah:

Mr. Visions: Why do you think the bible is ment to be taken literally? Even if it was, through all its various mutations and translations, guided by god so that no one could add their personal bias to it...Why would god be so literal? A being powerful enough to manifest an entire universe as an expression of its will seems (to me atleast) to be a bit beyond our ability to transcribe literal meanings from. I don't want you to think I'm attacking you or your beliefs, I would just like to discuss it.

I take God literally because of one guy named Jesus, you know, the guy who literally walked around, curing people of uncurable diseases, healing cripples, loving acts like that. He was a real person, claiming and proving he was the Son of God, God in the flesh. He was like, "aeeeee, I'm God, in the flesh" (my attempt to bring some humar into a thread like this). I feel if we couldn't take God literally, there wouldn't be Christianity, or even Judaism for that matter. There are some things that are figurative in the bible, like images in Revelation and Daniel, but I'm pretty sure God is not. Just cause he's omnipresent and comes in the forms of burning bushes and pillars of fire doesn't mean he is not literal. All those things should prove his Literal existance even more. I know that are humble vocabulary can not completely grasp the being of God. It's like explaining a color without naming it, or describing a piece of art. It's like taking a foriegn language for the first time. Listen to someone who is fluent, and you can get completely lost, but if they come down to yor level, and speak in basic terms, you can recognize basic words and possibly get the idea. Same with God. I hope we believe that something beyond greatness is possible to surpass our understanding. That's one of the many things that makes Him greater than us.

- Visions

MoP
July 28th, 2005, 05:34 PM
Mr. Visions, I hope you realise that the Bible was written by men. As you said yourself earlier, you may make mistakes, because you're only human.

The people who wrote and recorded (or made up, take your pick) the events in the Bible were human. Humans make errors. What is the likelihood of a book as old and large as the Bible containing errors? Translations? Occurences that could not be explained in any other way at the time? Personal politics and influences on what was written?

You cannot possibly know, today, that the various people who wrote and compiled the Bible did not have some other agenda, odd idea, or were maybe even half-crazy when working on it.

The Bible was written by men, not God, although you seem to be taking it so literally that it might as well have been written by Jesus himself.

Consider that...

Mr. Visions
July 28th, 2005, 05:34 PM
Who created God, Mr. Visions?
And how can you be sure that the Bible really represents the word of the creator of this universe? What makes you so sure that the Bible isn't really the word of the devil trying to lure you over to his side?

Could something of love and compassion, elements of moral good and virtue come from the devil? Jesus was asked the same things when he healed the sick and cast out devils. He was accused of using devils to do good works. Why would the devil want to do that. I believe that God said even through his prophets and servants that the Word is true, and the Word is Jesus Christ. The Bible which contains Christ's words, the devil? That's one thing I find contradictory. In fact the bible contains the words on Moses as well, also found in the Torah. Was moses of the devil. He freed an oppressed people in bondage. That sounds good to me. Noah is in there, too. He helped carry on the animals and virtuous people into "the new world" and helped give the world a rainbow. Doesn't everyone love rainbows (if you don't, I'm sorry)? Rainbows aren't evil. If you don't think this event happened, climb Mount Everest sometime and explain the large ship that sits up there.
Honestly, I present you with this information. I don't have all the answers, I never claimed to know everything, like I said, I'm human. But I believe in a faith that I believe guides me to the ultimate truth that everyone longs for, and can except if my feeble mind does not grasp it all. But, I'll keep trying.

- Visions

WindWalker
July 28th, 2005, 05:49 PM
If you don't think this event happened, climb Mount Everest sometime and explain the large ship that sits up there.
Ok, I'm all with ya, Mr. Visions, but please check your facts. There is no large ship on top of Mt. Everest. The Ark landed on the top of Mt. Ararat, believed to be in Turkey. Everest is in Napal. Even so, the Ark has never been found. There were some elaborate hoaxes, but nothing concrete.

That said, as I mentioned, I agree with you, but you really are wasting your time. Take it from someone who knows.

Mr. Visions
July 28th, 2005, 05:50 PM
Mr. Visions, I hope you realise that the Bible was written by men. As you said yourself earlier, you may make mistakes, because you're only human.

The people who wrote and recorded (or made up, take your pick) the events in the Bible were human. Humans make errors. What is the likelihood of a book as old and large as the Bible containing errors? Translations? Occurences that could not be explained in any other way at the time? Personal politics and influences on what was written?

You cannot possibly know, today, that the various people who wrote and compiled the Bible did not have some other agenda, odd idea, or were maybe even half-crazy when working on it.

The Bible was written by men, not God, although you seem to be taking it so literally that it might as well have been written by Jesus himself.

Consider that...

I under stand your point, and agree with you. The Bible was written by man. In fact, the books that actually made it into the Bible we have today we're chosen by the Catholic church, an institution which is full of it's own problems (No offense the Catholics, other churches have problems too because they do have people who run them and not all of them are on God's agenda). But in the same way, do you really thing a book that has lasted this long, created over so many years, and translated so many times, could have been made only by man. It's called divine inspiration. These aren't just ordinary men who wrote down those words. These are men who were porphets and leaders, men who even walked and learned from Christ. Many of which died because of the Words they spoke. Can you find something in the Bible that instructs us to do some that is behind someone's own agenda and conflicts with the rest of the Bible? Does it tell me to hate people, or kill, or commit acts of wrong to my fellow man? I would like to be presented with these if you do, but I have a feeling there not in there. I think if the Bible had someone's personal agenda or idea of corruption, it would kinda stick out from the rest of the words in the texts.
Martin Luther King used the bible to help us all recieve equal rights. Did He have a personal agenda? Yes, and have freedom. Did he use the Bible for his own "personal politics"? Yes. But it is only because He knew that the truth of freedom was an idea and belief long before his time. He also knew That God left his word for us to stand on. Was He later on assassinated? Yes, but Martin Luther King's realized that like many of the words in the Bible, they are bigger that ourselves. And even though we might perish for a time, God's word will last forever, as it has proven to have done.
Again, I respect the respect the thoughts and viewpoints of others because that is the freedom we are given, and that freedom allows me to type what I do. But answer me this. Would it make since that the word God told us to follow, speaking of morals and virtue and goodness, is not to be trusted?

- Visions

Mr. Visions
July 28th, 2005, 05:56 PM
Like I said, I am human. I had always thought it had been stumble upon...

http://news.nationalgeographic.com/kids/2004/05/noahark.html

I guess we all have to take a trip there sometime for ourselves to prove our doubts then, hahaha. You were right about Turkey, as well. And I know this thread can go on forever, because with truth, doubt also exists. I'm just present these things while I'm here. It will always be worth is worth it to someone.

- Visions

MoP
July 28th, 2005, 06:14 PM
I can also post links to the National Geographic, concerning the existence (or lack thereof) of Noah's ark...!

http://news.nationalgeographic.com/news/2004/09/0920_040920_noahs_ark.html

:)

Sinix
July 28th, 2005, 06:25 PM
Last I checked, we weren't doing political and religious arguements in the lounge... don't know why they're popping up again.

Besides, we all know Gil Gerard went back in a time machine and ejaculated into the primordial ooze.

dfacto
July 28th, 2005, 06:44 PM
But what our scientist does not realize is that every time he makes a measurement, the Flying Spaghetti Monster is there changing the results with His Noodly Appendage.

That sounds pervy! :perv:

(at least to me and my gutter-bound mind)

Mr. Visions
July 28th, 2005, 07:00 PM
Great observation MOP, but I never claimed (and neither does the Bible) claim that the ark was going to exist in Mt. Everest forever, just that it did at one point. It is possible it could exists in a number of locations, but the fact is it exists, and a ship in a mountain, no matter where it may be, is an awkward place fore it. It could exist in a thailand man's backyard who just happens to refer to himself as the Flying Spaghetti Monster... just maybe...

- Visions

Ssenkrah Semaj
July 28th, 2005, 07:23 PM
You know what pisses me off?

These threads are always started by somebody believing in Evolution going on the attack. The mob jumps in and starts ripping on everyone who believes in God, because that's the one unnacceptable thing to do on this forum. These same "generally" left-minded people who are so "tolerant" of all people's everywhere; except Christians.

Look, get pissed if you want at Bush for misusing religion, and even discuss the merits of the issue at hand if you want. But quit ganging up on, and ridiculing people's beliefs because you disagree with them.

Get back to work, hypocritical assholes.

You know what pisses me off?

When christians give this sob story about how they are being persecuted...what bullshit. I live in Georgia and am constantly being persecuted and ganged up on by family, friends, and strangers for my beliefs. Boo friggin hoo you have to read a single thread where you come upon people who share the same opinions and ideas about evolution. This entire country is being guided by the christian-faith so save all the ganged up sob story crap cause I ain't buying it.

Get back to discussing you open minded bitches :)

Ssenkrah Semaj
July 28th, 2005, 07:26 PM
Great observation MOP, but I never claimed (and neither does the Bible) claim that the ark was going to exist in Mt. Everest forever, just that it did at one point. It is possible it could exists in a number of locations, but the fact is it exists, and a ship in a mountain, no matter where it may be, is an awkward place fore it. It could exist in a thailand man's backyard who just happens to refer to himself as the Flying Spaghetti Monster... just maybe...

- Visions

Mount Everest...???? Quit saying Mount Everest...it was Mount Arat....and there is no evidence whatsoever to support that...they saw some satelitte photographs and the faithful being the faithful saw what they wanted to see...their were some expeditions they found some wood...and it was dated to reveal it was not the ark...end of story...next.

You want to go onto the shroud of turin now or the ark of the covenenat?

Ssenkrah Semaj
July 28th, 2005, 07:31 PM
Urg...I hate these discussions.



I believe most of Genesis Chapter 2 is basically a summary of what had taken place in the first chapter. I don't really think it's saying Man was created first. In the Hebrew text, there are no chronological markings throughout that part of Ch. 2, much unlike Ch. 1.

Just my $0.02, anyways.

No read it again...1 chapter says man was created than beast...the other chapter says beast was created than man....I know it's hard to follow but try for me.

Gen.1:25 And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
Gen.1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.

Gen.2:18 And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him.
Gen.2:19 And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof.

Mr. Visions
July 28th, 2005, 07:56 PM
Again, the Everest thing... My bad.:404sign:

= Visions

Ssenkrah Semaj
July 28th, 2005, 07:59 PM
Dude my bad Visions I didn't mean to sound cynical (which I clearly was..sorry)...jetpacks statement got me in a different mood. I appreciate your views.

WindWalker
July 28th, 2005, 09:01 PM
No read it again...1 chapter says man was created than beast...the other chapter says beast was created than man....I know it's hard to follow but try for me.

Gen.1:25 And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
Gen.1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.

Gen.2:18 And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him.
Gen.2:19 And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof.

Yes, thank you, I've probably read it nearly a hundred times. You must also take it in context with the original text. It is actually more of a translation problem than anything.

As you stated, between the creation of Adam and the creation of Eve, the KJV/AV Bible says (Genesis 2:19) ‘out of the ground the LORD God formed every beast of the field, and every fowl of the air’. On the surface, this seems to say that the land beasts and birds were created between Adam and Eve. However, Jewish scholars apparently did not recognize any such conflict with the account in chapter 1, where Adam and Eve were both created after the beasts and birds (Genesis 1:23–25).

Why is this?

Because in Hebrew the precise tense of a verb is determined by the context. It is clear from chapter 1 that the beasts and birds were created before Adam, so Jewish scholars would have understood the verb ‘formed’ in Genesis 2:19 to mean ‘had formed’ or ‘having formed’. If we translate verse 19 as follows (as one widely used translation does), ‘Now the LORD God had formed out of the ground all the beasts of the field …’, the apparent disagreement with Genesis 1 disappears completely.

Care to hear more? I'm sure you're not convinced yet.

jetpack42
July 28th, 2005, 09:18 PM
Sob story? Ninja Please!* Since when did two wrongs make a right? We're not to blame for your friends, family, or Georgians, so don't act like we are. It's obviously not cool to you for people to make fun of you/push thier beliefs down your throat, so how do you rationalize it the other way? Grow up.

*(c) el coro

stoph
July 28th, 2005, 09:32 PM
The problem with the whole creation argument is that those who believe in it don't know which one they believe in, the book of Genesis contradicts its very self on what happened.

Gen.1:25
And God made the beast of the earth after his kind, and cattle after their kind, and every thing that creepeth upon the earth after his kind: and God saw that it was good.
Gen.1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth.

Gen.2:18 And the LORD God said, It is not good that the man should be alone; I will make him an help meet for him.
Gen.2:19 And out of the ground the LORD God formed every beast of the field, and every fowl of the air; and brought them unto Adam to see what he would call them: and whatsoever Adam called every living creature, that was the name thereof.

Intelligent design? Hilarious! ...How about a book that doesn't contradict itself within the very first chapter!

haha ok so i freed up a little time (still gotta write a few thousand words this weekend, tho..) and, instead of paraphrasing Creationist literature ill merely point you to this link, written by Biblical scholars, that shows quite simply that there is (and never has been) a contradiction between Genesis 1 and 2.

here you go. (http://www.answersingenesis.org/creation/v18/i4/genesis.asp)

:)

sorry man, im nibbling but your bait isnt tastey enough for my time :P

WindWalker
July 28th, 2005, 09:36 PM
Sob story? Ninja Please!* Since when did two wrongs make a right? We're not to blame for your friends, family, or Georgians, so don't act like we are. It's obviously not cool to you for people to make fun of you/push thier beliefs down your throat, so how do you rationalize it the other way? Grow up.

*(c) el coro
:) I was just wondering that myself.

I always try not to push my beliefs on others (though, I admit, I slip on occasion, just like everyone else). Oh, if they ask, I'll tell 'em. Heck, if they don't ask, I'll tell 'em anyways. You believe it, great. You don't, that's your choice.

Don't ya just love those people who goes around saying, "Didjah know Jesuswascrusifieddiedandroseagainjustsoyoucouldbes aved? Repeat this prayer after me, 'Lord Jesus, come into my life, forgive me of my sin, I SAID REPEAT IT!"

Yeah. That's not me. Unfortunately, there are LOTS of Christians who honestly think that by beating it into you with a two-ton Bible, you're gonna get "saved". Pah!

My apologies to whoever has been the victim of a severe Bible-thrashing, on their behalf. People, reguardless of what they know or believe, etc., often do very stupid things. :)

CaptainInsano
July 28th, 2005, 09:38 PM
Maybe we shouldn't start any more religious or political threads... :S

WindWalker
July 28th, 2005, 09:49 PM
Well, 'stoph, you just made my post a waste of time. ;)

Maybe we shouldn't start any more religious or political threads... :S
Hehe. Aww, and miss out on all the fun? Never!

This is why I said, "I always hate these discussions." I really don't hate the discussions, I just hate it when people get all whiney about it or start flaming. *sigh* I suppose people can't be entirely trusted to keep things civil/mature. It's a shame, really. :[

stoph
July 28th, 2005, 10:01 PM
haha sorry, WindWalker, didnt catch that one :)

figure2
July 28th, 2005, 10:28 PM
These threads are always started by somebody believing in Evolution going on the attack. The mob jumps in and starts ripping on everyone who believes in God, because that's the one unnacceptable thing to do on this forum. These same "generally" left-minded people who are so "tolerant" of all people's everywhere; except Christians.

Look, get pissed if you want at Bush for misusing religion, and even discuss the merits of the issue at hand if you want. But quit ganging up on, and ridiculing people's beliefs because you disagree with them.

Get back to work, hypocritical assholes.
Jetpack,

In this case this thread was started by someone who actually reads a newspaper and keeps up on current events. This satire was aimed at the Kansas school board, not Christians or Creationists. The issue is whether the Creationists on the school board have the right to impose their beliefs on the public school science curriculum regardless of the children's religion or their parent's beliefs. The issue is also whether the children in the public school system would be served or cheated by replacing a solid science education with politically-charged religious ideas. If the Creationists on the Kansas school board have their way, it's the citizens of Kansas, not Christians who would be ganged up on.

Because of the Kansas School Board's actions, they have been ripe for satire like "Flying Spaghetti Monster" and deservedly so.

SJ Bennighof
July 28th, 2005, 10:32 PM
Jetpack,

[...]

Because of the Kansas School Board's actions, they have been ripe for satire like "Flying Spaghetti Monster" and deservedly so.

Right, and I wholeheartedly agree, but no one's even talking about the letter anymore. Jet certainly wasn't.

Ssenkrah Semaj
July 28th, 2005, 11:18 PM
Yes, thank you, I've probably read it nearly a hundred times. You must also take it in context with the original text. It is actually more of a translation problem than anything.

As you stated, between the creation of Adam and the creation of Eve, the KJV/AV Bible says (Genesis 2:19) ‘out of the ground the LORD God formed every beast of the field, and every fowl of the air’. On the surface, this seems to say that the land beasts and birds were created between Adam and Eve. However, Jewish scholars apparently did not recognize any such conflict with the account in chapter 1, where Adam and Eve were both created after the beasts and birds (Genesis 1:23–25).

Why is this?

Because in Hebrew the precise tense of a verb is determined by the context. It is clear from chapter 1 that the beasts and birds were created before Adam, so Jewish scholars would have understood the verb ‘formed’ in Genesis 2:19 to mean ‘had formed’ or ‘having formed’. If we translate verse 19 as follows (as one widely used translation does), ‘Now the LORD God had formed out of the ground all the beasts of the field …’, the apparent disagreement with Genesis 1 disappears completely.

Care to hear more? I'm sure you're not convinced yet.

You completely plagurized Stoph's website lol http://www.answersingenesis.org/creation/v18/i4/genesis.asp ! I still love you thanx for the quotation...when I figure out just what the hell it's saying I will give my answer.

Ssenkrah Semaj
July 28th, 2005, 11:25 PM
Sob story? Ninja Please!* Since when did two wrongs make a right? We're not to blame for your friends, family, or Georgians, so don't act like we are. It's obviously not cool to you for people to make fun of you/push thier beliefs down your throat, so how do you rationalize it the other way? Grow up.

*(c) el coro

Good advice coming from the first person to post demeaning names about the believers in evolution on this thread..."hypocritical assholes"...that was mature indeed....It seems as though most of the threads you post in that state opposing views to your own, your first action is start calling people names...Grow up indeed.

JERI
July 29th, 2005, 03:43 AM
You heathens have tainted this thread with lackluster, cliche debates. The Flying Noodly One will come for you!! He will not forgive!!

WindWalker
July 29th, 2005, 09:10 AM
The issue is whether the Creationists on the school board have the right to impose their beliefs on the public school science curriculum regardless of the children's religion or their parent's beliefs.
Ah, isn't that always the issue? But then, do evolutionists (or anyone else for that matter) have the right to impose their beliefs any more than Creationists?

Personally, I think kids should be taught ALL origin theories. But even then, I doubt it would change anything. Evolution would still be favored in most public schools. After all! It's science! You can't prove religion, but science, that's where the real facts are!

Haha, facts. I recently read a science journal saying how Creationists were complaining about evolutionists stating theories as fact. The writer when on and on about how evolution is a "fact", but "fact" doesn't really mean "fact", it means something else, but it's a "fact". Well, at least it was good for a laugh or two!

Creationists can argue til they're blue in the face, but reguardless of if other theories of intelligent design are taught, evolution will always be favored because it's been so instilled in our own beliefs. Yes...beliefs. Evolution is just as much a belief as Creationism.

Now I'm just waiting for someone to say, "No one has the right to impose their beliefs on anyone!"

WindWalker
July 29th, 2005, 09:22 AM
You completely plagurized Stoph's website lol http://www.answersingenesis.org/creation/v18/i4/genesis.asp ! I still love you thanx for the quotation...when I figure out just what the hell it's saying I will give my answer.

Ah, Ken won't mind. ;)

Yeah, this is why all Christians should take a few classes in Greek and Ancient Hebrew...so they can really understand what they're reading. Unfortunately, so few really do. They just know what the preacher tells 'em.

Go ahead and read through some of the articles on AnswersInGenesis.org. Some of them are quite interesting. If anything, maybe you'll see the Bible from a different perspective. :^^:

dfacto
July 29th, 2005, 09:32 AM
Ah, isn't that always the issue? But then, do evolutionists (or anyone else for that matter) have the right to impose their beliefs any more than Creationists?

It's a matter of where those beliefs are imposed. Evolution is a scientific theory, and is therefore a clear contender for being taught in a science class. Creationism is not, and therefore has no place being put in a scientific curriculum. The foundation of evolution is scientific in nature, whereas the foundation of creationism is purely faith based. Faith has no place in science class. If alternate theories should be taught in a science class, then make sure that they are scientific, otherwise shove them into a theology class.

Creationists can argue til they're blue in the face, but reguardless of if other theories of intelligent design are taught, evolution will always be favored because it's been so instilled in our own beliefs. Yes...beliefs. Evolution is just as much a belief as Creationism.

Everything is a belief when you get down to it, but if one accepts the world as it is (aka: doesn't think that everything is a lie, and that we're in the Matrix or some shit like that) then evolution is more than just a belief. Evolutionary theory is based on science and an extensive body of evidence, and evolution itself, the change of frequency of genes in a given population, is an indisputable fact. When that is taken into account it can be reasoned that evolution is more than just a belief (though it is that as well). It exists in the minds of those who believe it, but it is also shown by the world itself, through all the evidence available. Creationism on the other hand is unscientific, does not accurately predict or tie together the available evidence, and is based upon the existance of God, which is also unscientific and neither provable nor disprovable. It is a belief, sustained in the minds of those who believe it, but not reflected by the world itself.

As I said, it's science vs faith, and faith has no business being pushed as science, just as science has no business being pushed as faith.

Would those who want creationism and other religious beliefs taught in science class be willing to let science into church? Teach creationism in the class, and evolution from the pulpit? I'd rather keep things where they belong.

EDIT: also think about why it is so instilled in our beliefs. Evolution has taken the forefront simply because it "works". It is the best scientific explanation out there, and while not perfect or complete, it beats the competition by miles. In a world where science is proven to work and bring us big advances, I see no reason why it should be selectively muzzled simply to jive with people's various "Big Guy in the Sky" stories.

WindWalker
July 29th, 2005, 09:58 AM
...
also think about why it is so instilled in our beliefs. Evolution has taken the forefront simply because it "works". It is the best scientific explanation out there, and while not perfect or complete, it beats the competition by miles. In a world where science is proven to work and bring us big advances, I see no reason why it should be selectively muzzled simply to jive with people's various "Big Guy in the Sky" stories.
"Works," indeed. It is the best scientific explanation because scientists can't get past what they can see.

I mean, think of the balance of life...tiny, nearly invisible little atoms bustling about so perfectly; neutrons, protons, and electrons, all kept in a delicate balancing act. If things like gravity, magnetism, and teensy tiny electrons with seemingly nothing holding them in place can exist, why couldn't there be a scientific explanation for God? I'm not saying it's plausible, but isn't it at least possible? There are probably many forces that people have never known about that we may or may not discover in later years.

Ah, enough, I'm babbling now.

Anyhoo, I think what a lot of people don't see is that Creationism can be scientific, if veiwed from the right perspective. When it comes to God, yes, I look at things from a faith-based perspective. But when it comes to science, I tend to look for the real proof, especially being a formerly devout evolutionist. Yes, there are a LOT of things in Creationism that haven't been, and probably cannot be proven. However, I see just as many problems with evolution.

dfacto
July 29th, 2005, 11:33 AM
"Works," indeed. It is the best scientific explanation because scientists can't get past what they can see.

You're wrong. Proof? Black holes were theorized before one was ever "seen". I think that's proof enough. That's the thing about science and scientific theories. It can predict things based upon past experience, but without direct proof, and then have that proof appear to validate the theory. Evolution can predict in what strata one might find a transitional fossil, and *presto* there it is (when it is eventually found, that is).

why couldn't there be a scientific explanation for God? I'm not saying it's plausible, but isn't it at least possible?

Yes, but until you get the proof, or at least a theory (read: scientific theory, aka, not a hypothesis), it's all talk, and should be treated as such.

Anyhoo, I think what a lot of people don't see is that Creationism can be scientific, if veiwed from the right perspective. When it comes to God, yes, I look at things from a faith-based perspective.

But that's the problem. The whole theory balances firmly (or unsteadily) on one single point: the existance of a creator. That point is, as of yet, just talk, and not in any way scientific, which destroys any structure built upon it. God is, until proven, a figment of our societal imagination, and that is definitely not something that can pass for science.


Yes, there are a LOT of things in Creationism that haven't been, and probably cannot be proven. However, I see just as many problems with evolution.

Well, that is why evolutionary theory is just that, a theory. It is not a law. However, the basics of evolutionary theory are irrefutable. The weak points lie in the ideas built upon the base, such as specific mechanics and triggers of evolution. On the other hand the foundations of Creationism are where the gaps lie, which is rather telling as to the worth of the theory.

Floris Didden
July 29th, 2005, 11:45 AM
Dfacto, I agree.

Nowadays I try to stay clear of these threads, but coincidently I stumbeld upon the following article and couldn't resist throwing more fuel on the fire ;) : http://www.sundayherald.com/50943

S.C. Watson
July 29th, 2005, 03:43 PM
Evolution is just as much a belief as Creationism.

No offense, but god, I just love bold faced ignorance. This is the crux of the whole problem here - the creationists camp holds that evolution is essentialy faith based, as their own ideas are. This is *factually* incorrect. Evolution, as has been hashed out in at least four previous threads to this, is observable, reproducable, and therefore fact, theological propaganda to the contrary not-withstanding.

As posted *many* times before in previous threads:
READ THIS: http://www.talkorigins.org/origins/faqs-mustread.html
AND THIS: http://www.talkorigins.org/faqs/faq-misconceptions.html

Thank you very much and have a nice day. I swear, I'm going to put those links in my sig!

S.C. Watson
July 29th, 2005, 03:46 PM
Dfacto, I agree.

Nowadays I try to stay clear of these threads, but coincidently I stumbeld upon the following article and couldn't resist throwing more fuel on the fire ;) : http://www.sundayherald.com/50943

Damn. I've been saying that for years! :nohope:

[edit] actually, it's kind of disturbing how close this guy reflects my own thoughts on some of these matters....

Floris Didden
July 29th, 2005, 03:57 PM
Damn. I've been saying that for years! :nohope:

[edit] actually, it's kind of disturbing how close this guy reflects my own thoughts on some of these matters....
Same. :vodkamachine:

jfrancis
July 29th, 2005, 09:42 PM
http://www.digitalartform.com/archives/images/nmh_sabreTooth.gif
I get why sabertooth cats have a radius and ulna in their forearms. They need to supinate their paws.

http://www.digitalartform.com/archives/images/nmh_mammoth.gif
But mammoths?

Now THAT'S intelligent design in action.

http://www.digitalartform.com/archives/2004/12/comparative_ana.html

stoph
July 30th, 2005, 12:45 AM
Evolution, as has been hashed out in at least four previous threads to this, is observable, reproducable, and therefore fact, theological propaganda to the contrary not-withstanding.

observable to an extent. Creationists have no problem with evolution as a whole. microevolution aka the adaptation of a species without requiring additional information in the DNA is acceptable, i mean its perfectly within a creatures potential to adapt. speciation is also acceptable. macroevolution is the stumbling block, as it implies that, via random mutations or natural selection (all viable processes), that an animal may exceed its potential and become a completely different animal (in biological standards). this has not been observed. EVER. if it has and i am mistaken, please correct me.

S.C. Watson
July 30th, 2005, 01:08 AM
observable to an extent. Creationists have no problem with evolution as a whole. microevolution aka the adaptation of a species without requiring additional information in the DNA is acceptable, i mean its perfectly within a creatures potential to adapt. speciation is also acceptable. macroevolution is the stumbling block, as it implies that, via random mutations or natural selection (all viable processes), that an animal may exceed its potential and become a completely different animal (in biological standards). this has not been observed. EVER. if it has and i am mistaken, please correct me.
Galopogus islands. (i.e. many examples of animals known elsewhere that have developed into other, distinct species, but who's origins are easily identifiable).

For further fun with zoological evolution, please refer to your friendly neighborhood fossil record.

Thank you, and have a nice day :)

emily g
July 30th, 2005, 01:28 AM
this has not been observed. EVER. if it has and i am mistaken, please correct me.
You are mistaken. Of course, it can take millions of years for speciation to occur, so often we can't live long enough to actually see it. But we have a clear fossil record which can be observed.
I'll try and provide you with more info and some links if you want, but I would rather not waste my time if you won't actually read them. It has happened many times before that links have been provided but the respondents won't even do the work to slog through the material.
And, yes, it can be quite a slog to get informed about the issue. I have done the work, but I suspect most people haven't and won't. Just let me know what camp you are in (someone who will do the work or someone who won't), ok?

emily

P.S. 'stoph, you say that the animal must "become a completely different animal (in biological standards)". You know what those biological standards are, right? According to biological standards, a new species is formed when the animals can no longer breed (and produce fertile offspring) with members of their own species. This is very, very easy to prove. In fact, it is something that can easily be seen in a matter of only a few years.
You have totally shot yourself in the foot by making this your argument.

Contrary to what you have said, you are probably wanting to see evidence for a greater change than mere biological speciation requires. The evidence exists for that also, but I'm just pointing out the flaw in your current argument.

wassermelone
July 30th, 2005, 01:39 AM
observable to an extent. Creationists have no problem with evolution as a whole. microevolution aka the adaptation of a species without requiring additional information in the DNA is acceptable, i mean its perfectly within a creatures potential to adapt. speciation is also acceptable. macroevolution is the stumbling block, as it implies that, via random mutations or natural selection (all viable processes), that an animal may exceed its potential and become a completely different animal (in biological standards). this has not been observed. EVER. if it has and i am mistaken, please correct me.

There is no difference between macro and micro evolution. You either believe in both or none at all. There is no scientific support for differentiation between the two. And sorry, but its just flat out logical that a series of small changes can lead to a large change when looking at the beginning and ending points.

emily g
July 30th, 2005, 02:22 AM
oh man, this topic is like a phoenix

religious people, do some inner searching and think about the reasons why you feel like you need religion in the first place.
Occam's razor is your friend
Hey, there's nothing wrong with being religious. Just know where your boundaries are. There are some things I believe in that I know I can't prove. But I accept that and I don't try to do things like mis-use science to support my beliefs.

emily

Edit: This was my 666th post! Oooh this is so creepy--I must be preaching false doctrine from the devil! Nah, just joking with y'all. :)

stoph
July 30th, 2005, 04:00 AM
ok so i misspoke, i apologise. thanks for pointing out my errs, i assure you im not as "dumb" as that post suggests. if anything my debating skills are a little rusty. i was a very regular Apologetic at the R&P forums on myspace.com for some time before year 12 and in that time learnt quite a bit (you wanted to know where i was at, emily).

ill try and make this as painless as possible, as i have many thousands of words (quite literally) to write before this monday, that and i promised i wouldnt get sucked into this. oh crap. so heres my understanding of what we have here..

microevolution implies changes that are made within the constructs and potential of the organisms DNA. it suggests small changes, for instance, Darwin's finches (for those of you familiar with his studies). when i say potential i mean the animal's capacity to change based on the boundaries set by it's DNA. one factor i believe is "recombination" (for those of you familiar with Medel's work), meaning that certain traits would be brought out and exhibited by the organism when it required those traits, whilst others that were perhaps unnecessary at the time would recede, only to appear in the organism's offspring if it were once again required. thus we have a shuffling of information, if you wish; a process where information is neither gained nor lost.

mutations are (99% of the time) credited to be detrimental; adding entropy to the structure of the DNA as opposed to bringing beneficial (and new) data to the organism. basically, it corrupts whatever is already there, which leads to an impure representation of that particular trait in the animal. natural selection is common sense more than anything, as it is only right that an animal with thick fur would survive better in artic climates than his cousin that is bald. this only ensures that the furry animal will have more offspring with a trait of similar benefit. it is basically recombination all over again, that being the bald trait of the furry animal's cousin is still within the furry animal's potential to revert to later on.

in short, macroevolution implies the increase of information (capacity, potential, etc etc) in an organism, making it more than what it should be. by what ive said, do any of microevolution's methods describe such an increase? or is it just wishful thinking on our behalf that if one application of the word "evolution" is proved to be correct that all others can just as easily be accepted? the combination and accumilation of microevolutionary steps is not the logical step to macroevolution.

dfacto
July 30th, 2005, 05:54 AM
mutations are (99% of the time) credited to be detrimental; adding entropy to the structure of the DNA as opposed to bringing beneficial (and new) data to the organism.

Firstly, I believe that it has been proven that almost all of the genetic traits required for a drastic evolution are already contained within the human genome, and I would assume that the same applies to other animals. This means that the capactiy to become a whole different species, genus, etc (dunno how high up the ladder it goes) is built in and requires no mutation.

Now, mutation is required for many evolutions of course (couldn't have gone from a prokaryotic to a eukaryotic cell without it), but think about what you said. 99% of mutation is detrimental. First of all, is that a solid number, or is that one of those "out of the ass" numbers? When it comes to percentages, it's best to give some links to back it up. Also, if 99% is correct, that still doesn't mean much. Life on earth has existed for roughly 3 billion years. Now imagine how many cell divisions, births, asexual reproductions, etc have occured within that time. I'll give you a hint and point out that the number is FUCKING HUGE. Even 1% of the mutations that would appear in that time would be a staggeringly huge number, and plenty to add new genetic material to the populations affected.

by what ive said, do any of microevolution's methods describe such an increase?

Microevolution refers to any evolutionary change below the level of species, and refers to changes in the frequency within a population or a species of its alleles (alternative genes) and their effects on the form, or phenotype, of organisms that make up that population or species.

macroevolution is used to refer to any evolutionary change at or above the level of species. It means the splitting of a species into two (speciation, or cladogenesis, from the Greek meaning "the origin of a branch") or the change of a species over time into another (anagenesis, not nowadays generally used). Any changes that occur at higher levels, such as the evolution of new families, phyla or genera, is also therefore macroevolution, but the term is not restricted to the origin of those higher taxa.

http://www.talkorigins.org/faqs/macroevolution.html

Well, lets see. http://www.talkorigins.org/indexcc/CB/CB910.html

Conclusion: you're wrong, they're both possible. Both micro and macro evolution are possible and observable, and you're question is moot because it seems you don't know what macro and micro evolution mean.

What you are arguing about is not macro and micro evolution, but rather about mutation, and only mutation. You aren't interested in the splitting of species, but simply the introduction of new genetic material into a genome through mutation, which is independant of macro evolution to a degree.

I have no solid response that would explain mutation fully, so I'll do some searching and try to bring some info together. Unless someone beats me to it.

NoSeRider
July 30th, 2005, 08:51 AM
Micro Evolution is an Observable Fact

http://www.exchangedlife.com/Creation/macro-evol.shtml

Micro-evolution is a fact. This has never been disputed by anyone who understands what micro-evolution is. Micro-evolution is the alteration of a specific trait due to natural response. Take a look at Darwin’s observation of the changes in finches. Isolated in the Galapagos Island, Darwin discovered finches that had much longer beaks than those found off the island. His assumption was that evolution was changing this species. However, these finches remained finches. Princeton professor Peter Grant completed an 18 year study of the finches on this island. He concluded that during drought years, the finches with shorter beaks died off because with a limited supply of seeds, only those that could reach the grubs living under tree bark could survive. With limited resources on a small island, these finches could not migrate to find food. We clearly observe natural selection, but not macro-evolution.

So, I don't see how you can't take the next step and believe in Macro Evolution?.....that is evolution over time that takes place over centuries, millennium.

Scientists wrote a whole damn book about how they observed evlutionary changes in finches over a 18 year period!!!....telling me they wasted their time?
http://www.project2061.org/publications/rsl/online/TRADEBKS/REVS/BEAKFINC.HTM

If I spent 18 years out on a desert island saying this is how it is, and somebody said I was full of it....I'd be pissed off too.

Hamsta
July 30th, 2005, 09:05 AM
So parrots and peg legs are not part of the full regalia? Can I substitute a flintlock (or whatever) instead of the saber (or whatnot)

Hmm... maybe I should make a new puzzle pirates free account to prepare for the spaghetti monster religious celebration

S.C. Watson
July 30th, 2005, 12:03 PM
There is no difference between macro and micro evolution. You either believe in both or none at all.

One point:

Evolution is *not* a matter of belief. To say one believes in evolution is akin to saying that one *believes* that water is wet, or that fire burns.

Facts can not be picked and chosen at will like beliefs. This is not the food court of spirituality, however the labratory of reality.

Ssenkrah Semaj
July 30th, 2005, 12:55 PM
Edit: This was my 666th post! Oooh this is so creepy--I must be preaching false doctrine from the devil! Nah, just joking with y'all. :)

Actually since the discovery of the dead sea scrolls and their translation it has been revealed that the devils number is actually 616 in revelations, it was mistranslated...-as reported on the Discovery Channel.

Also they believe the reason why that is his number is because of an ancient hebrew name game where letters were assigned numerical value. John gives references to a 7 headed dragon while he was exiled on an island by the roman empire which at that time had 7 major cities. Who was the emperor of rome during that time and who's name coincidentally equals the value of 616? The infamous Caligula.

sorry just had to share that with everyone.

wassermelone
July 30th, 2005, 01:24 PM
One point:

Evolution is *not* a matter of belief. To say one believes in evolution is akin to saying that one *believes* that water is wet, or that fire burns.

Facts can not be picked and chosen at will like beliefs. This is not the food court of spirituality, however the labratory of reality.

Well I'll spare you the philosophical "can't prove anything"/Plato's Cave/Descartes diatribe, but I think that "saying that one *believes* that water is wet" is perfectly valid. :P

But other than that I perfectly agree. Not "believing" (sorry to step on your toes again :teeth: ) in evolution is akin to disbelieving in the existance of wood.

brokk
July 30th, 2005, 02:27 PM
You know what pisses me off?

These threads are always started by somebody believing in Evolution going on the attack. The mob jumps in and starts ripping on everyone who believes in God, because that's the one unnacceptable thing to do on this forum. These same "generally" left-minded people who are so "tolerant" of all people's everywhere; except Christians.

Look, get pissed if you want at Bush for misusing religion, and even discuss the merits of the issue at hand if you want. But quit ganging up on, and ridiculing people's beliefs because you disagree with them.

Get back to work, hypocritical assholes.

True, hypocritical as charged.

Ok, don't get mad, I'm going to try to say something here. Teaching religion in a science class is like discussing postdarwinism in chuch. Neither of them are "wrong" and neither of them are "right" by their own, it all depends on how you think. The thing is, science operates with a certain methodology. In a science class, if a theory does not adhere to this methodology, its not scientific, and therefore sensless to be taught in a science class. This is not to say that its -wrong-. It just means it can't be regarded as scientific, and cannot be taught as science. The same goes the other way around, you cannot teach science in Sunday Mass because science is not biblical, and therefore, senless to be taught in church. Intelligent Desing can however, be taught as what it is (a pseudoscience). I don't think pseudoscience is less meritory than science. What differences them is how rigourously the theory adheres to the scientific method. Pseudosciences that adhere to the scientific method are sometimes considered as "proto-sciences". Some proto-sciences, given a certain amount of time, later drop the "proto" and just stand as "science". Depending on who you ask, this is the case of psychoanalysis.

The argument at hand here, and in the letter, is not ridiculizing a certain belief system. It is about ridiculization, but (and this is extremly important) The ridiculization of teaching a pseudoscience, as a science, in a science classroom. If Intelligent Design were to be discussed at a science classroom, it should be under the consideration that its a pseudocience, not a science. This has nothing to do with christianity, because the same thing could be said about psychoanalysis. It has to do with more or less adherence to the rigourousness of the scientific method.

Considering the above, yes, I believe it is absolutely ridiculous to teach pseudoscience in a science classroom. I also believe it is absolutely ridiculous to teach postdarwinism in Sunday Mass.

My ridiculization was not at christian supporters, it was aimed at supportes of teaching pseudoscience in a science classroom. It could have gone the other way around for supportes of postdarwinism to be taught in Sunday Mass.

Hope that helped clear up some issues.



And now jetpack42 and Ssenkrah Semaj, quit the quarreling or I'll go Spaghetti Stalin on your asses!

Ssenkrah Semaj
July 30th, 2005, 02:43 PM
EDIT: It seems as though many people fail to realize that scholars of different religions and cultural backgrounds agree that evolution happened...that is not the same for creationism it only is argued by those of the christian faith. Okay lets have it your way people lets teach intelligent design in schools what is next faith healing for medical school?


Of course there are some that don't think faith healing would be a bad idea I'm sure, but you have to realize the reason why we have present day medicine is because faith healing doesn't get the job done.

wassermelone
July 30th, 2005, 02:59 PM
I could not disagree with you more Broken Spirit. you can't have your cake and eat it too....it seems as though many people fail to realize that scholars of different religions and cultural backgrounds agree that evolution happened...that is not the same for creationism it only is argued by those of the christian faith. Okay lets have it your way people lets teach intelligent design in schools what is next faith healing for medical school?


Of course there are some that don't think faith healing would be a bad idea I'm sure, but you have to realize the reason why we have present day medicine is because faith healing doesn't get the job done.

Um.

I do believe you misread his post.

His points:
Keep science to being taught in science classes.
Keep faith based stuff to being taught in church/mosque/whatever.

Your points:
Keep science to being taught in science classes.

You are not disagreeing.

Ssenkrah Semaj
July 30th, 2005, 03:09 PM
uhhhhhhhhhhhhhhhhhhh....oops :O

I love Jesus?

brokk
July 30th, 2005, 03:30 PM
Okay lets have it your way people lets teach intelligent design in schools what is next faith healing for medical school?

Um.

I do believe you misread his post.

His points:
Keep science to being taught in science classes.
Keep faith based stuff to being taught in church/mosque/whatever.

Your points:
Keep science to being taught in science classes.

You are not disagreeing.

Yup. I just want to make a sidenote because I thought the faith healing/modern medical issue to be interesting: Yes, I absolutely advocate for faith healing to be taught, to anyone who wishes to learn it. In fact, I advocate for anything and everything to be taught and to be learnt by anyone who wishes to do so, in the appropiate classes for each subject. I know it might sound insane, but I agree with a lot of what Paul Feyerabend states (which does not equate to everything). If you haven't heard of him, he's an epistemologist who basically says that you should be taught whatever you want to learn. Two key books on this are Against Method, and Science in a Free Society. Check them out if you haven't, they are pretty cool.

EDIT: Feyerabend advocates for theoretical anarchism, which is to say he believes its better to have "many" scientific method than "one". In spirit I agree, but in the practical reality of today, this is no where near being acomplished. In the meantime, I belive it is better to have "one" scientific method than a jumble of methodologies. It sounds contradictory, and well... I guess it is. Ironic.

Eric Lofgren
July 30th, 2005, 03:33 PM
because with truth, doubt also exists.

That should read Faith, not Truth. If science can't prove many things as true, there's no way religion can even come close to claiming it can.

MoP
July 30th, 2005, 03:39 PM
http://www.sundayherald.com/50943

Thanks for the link, Floris Didden - good read, made a lot of sense to me!

It makes zero sense to have any sort of religion in the mix with government, since if one gets in (such as Christianity in the current US government), how come none of the other religions have equal say in the matter? It's only fair that if one faith is allowed any sway over national laws, the other faiths should be allowed too.
It's all or nothing - and in this case, "nothing" makes infinitely more sense. With no religion trying to interfere in matters of state, there would be no squabbling other than personal choices, rather than overarching beliefs.

brokk
July 30th, 2005, 03:42 PM
MoP, I totally agree.

emily g
July 30th, 2005, 05:20 PM
Actually since the discovery of the dead sea scrolls and their translation it has been revealed that the devils number is actually 616 in revelations, it was mistranslated...-as reported on the Discovery Channel.

Also they believe the reason why that is his number is because of an ancient hebrew name game where letters were assigned numerical value. John gives references to a 7 headed dragon while he was exiled on an island by the roman empire which at that time had 7 major cities. Who was the emperor of rome during that time and who's name coincidentally equals the value of 616? The infamous Caligula.

sorry just had to share that with everyone.
Ahh, Semaj, I appreciate you trying to share some interesting facts, but I'm afraid I just can't trust what you say when it comes to interpreting scripture! :) (I know, I know, you saw it on the Discovery Channel, etc., etc. . . . Provide me with a link, please. :))

You have an uncanny ability to misinterpret what you read and/or you report dubious information on this subject (the whole YHWH thing . . .).

I am well aware of the symbolic significance of numbers used by John in Revelation, but I believe the whole 666 (or 616) = "name of some evil person here" interpretation is off the mark.

With that said, I think this is my favorite post of yours ever:
uhhhhhhhhhhhhhhhhhhh....oops

I love Jesus?
hahaha
emily

Ssenkrah Semaj
July 30th, 2005, 08:35 PM
Ahh, Semaj, I appreciate you trying to share some interesting facts, but I'm afraid I just can't trust what you say when it comes to interpreting scripture! :) (I know, I know, you saw it on the Discovery Channel, etc., etc. . . . Provide me with a link, please. :))

You have an uncanny ability to misinterpret what you read and/or you report dubious information on this subject (the whole YHWH thing . . .).

I am well aware of the symbolic significance of numbers used by John in Revelation, but I believe the whole 666 (or 616) = "name of some evil person here" interpretation is off the mark.

With that said, I think this is my favorite post of yours ever:

hahaha
emily

LMAO

OUCH!

going to the club find a link later but i have both of the dvds here at my house which you can purchase at any discovery store the series is called ancient evidence and the episode I am referring to is Mysteries of the apostles-Revelation: The end of the World.

stoph
July 30th, 2005, 09:41 PM
Firstly, I believe that it has been proven that almost all of the genetic traits required for a drastic evolution are already contained within the human genome, and I would assume that the same applies to other animals. This means that the capactiy to become a whole different species, genus, etc (dunno how high up the ladder it goes) is built in and requires no mutation.

Dr. Terry Mortenson puts it quite simply that "Amoeba DNA has no information for making hooves, hair, tails and eyes, but horse DNA does. Alligator DNA has no genetic information for producing feathers, hollow bones and one-way lung systems, but eagles do." your assumptions are incorrect in this case, im afraid.


Now, mutation is required for many evolutions of course (couldn't have gone from a prokaryotic to a eukaryotic cell without it), but think about what you said. 99% of mutation is detrimental. First of all, is that a solid number, or is that one of those "out of the ass" numbers? When it comes to percentages, it's best to give some links to back it up. Also, if 99% is correct, that still doesn't mean much. Life on earth has existed for roughly 3 billion years. Now imagine how many cell divisions, births, asexual reproductions, etc have occured within that time. I'll give you a hint and point out that the number is FUCKING HUGE. Even 1% of the mutations that would appear in that time would be a staggeringly huge number, and plenty to add new genetic material to the populations affected.

the endosymbiont theory is quite old hat. should have gone out with the 70's. old habits die hard, eh? also, the 3 billion years you quote is also quite debateable, as young earth theorists have quite a case built (that im sure youve heard before.. or have you?). so i couldnt gather every single mutation ever recorded and get an accurate, to-the-decimal figure, so sue me. basically, i chose the 99% to highlight the extreme impracticality of mutations.

youre missing my point with this whole argument - yes, mutations can be seen as beneficial, BUT (and a stress again, there is a proviso) a mutation has NEVER been observed to add additional structure to the DNA. the only perceivable role of a mutation is to corrupt whatever is there to begin with.


Conclusion: you're wrong, they're both possible. Both micro and macro evolution are possible and observable, and you're question is moot because it seems you don't know what macro and micro evolution mean.

i dont know what im talking about? thats a little ironic.. *coughhypocritecough* ok, let us turn to Wikipedia's definition so that we are both on the same page.

Microevolution: "is the occurrence of small-scale changes in gene frequencies in a population over a few generations, also known as change at or below the species level. These changes may be due to several processes: mutation, gene flow, genetic drift, as well as natural selection. Population genetics is the branch of biology that provides the mathematical structure for the study of the process of microevolution."

Macroevolution (an overview): "There are a number of views regarding macroevolution. Some evolutionary biologists, particularly Charles Darwin and those ascribing to the modern synthesis, see the only difference between microevolution and macroevolution as being one of scale. Other evolutionary biologists, including Gould, Schmalhausen, and Waddington, hold that microevolution and macroevolution are fundamentally different processes. Essentially the question is - how important are sudden developmental "spurts" to the overall process of evolution? Are they the driving force, or is gradual change the more important process?

Macroevolution is controversial outside the scientific community, and aspects of it are disputed by many movements such as creationism, intelligent design, and panspermia. Generally speaking, these groups differentiate between microevolution and macroevolution, asserting that the former is an observable phenomena, but that the latter is not. They have proposed a number of limits beyond which they believe evolution cannot occur. Proponents of Intelligent design and panspermia argue that the mechanisms of evolution are incapable of giving rise to instances of specified complexity and irreducible complexity. Proponents of creation biology assert that life was originally created in a finite number of discrete created kinds beyond which and between which no evolution can occur, and that the dominant source of biological change is population isolation and genetic drift, or the loss of the diversity of the original kinds, rather than an increase of genetic diversity through mutation."

and lastly, Mutations: "Mutations are permanent, sometimes transmissible (if the change is to a germ cell) changes to the genetic material (usually DNA or RNA) of a cell. Mutations can be caused by copying errors in the genetic material during cell division and by exposure to radiation, chemicals, or viruses, or can occur deliberately under cellular control during the processes such as meiosis or hypermutation. In multicellular organisms, mutations can be subdivided into germline mutations, which can be passed on to progeny and somatic mutations, which (when accidental) often lead to the malfunction or death of a cell and can cause cancer. Mutations are considered the driving force of evolution, where less favorable (or deleterious) mutations are removed from the gene pool by natural selection, while more favorable (or beneficial) ones tend to accumulate. Neutral mutations do not affect the organism's chances of survival in its natural environment and can accumulate over time, which might result in what is known as punctuated equilibrium, the modern interpretation of classic evolutionary theory. It should be noted that, contrary to science fiction, the overwhelming majority of mutations have no real effect."

id say thats pretty much what ive been saying all along. are you going to dispute this?

What you are arguing about is not macro and micro evolution, but rather about mutation, and only mutation. You aren't interested in the splitting of species, but simply the introduction of new genetic material into a genome through mutation, which is independant of macro evolution to a degree.

splitting of the species or "speciation" as i have referred to previously is perfectly viable, and i have no argument against it. it poses as no threat to my beliefs, and in fact supports scripture and a Creator. you, on the other hand, have no interest in discussing mutations, which is your stumbling block in regards to macroevolution as speciation cannot be responsible for the move from amoeba to man (no matter how many changes or how much time). ive said it before, macroevolution (contrary to popular belief) is not microevolution to the umpteenth power.

youre fighting an uphill battle here. i must return to my work, i wait for a response.

S.C. Watson
July 30th, 2005, 09:59 PM
Dr. Terry Mortenson puts it quite simply...

Dr. Terry Mortenson is also an outspoken proponant of Creationism, and therefore his word on evolution is suspect, and in my opinion, void.

Dr. Terry Mortenson (http://www.answersingenesis.org/events/bio.aspx?Speaker_ID=20)

stoph
July 30th, 2005, 11:20 PM
Dr. Terry Mortenson is also an outspoken proponant of Creationism, and therefore his word on evolution is suspect, and in my opinion, void.

Dr. Terry Mortenson (http://www.answersingenesis.org/events/bio.aspx?Speaker_ID=20)

youre applying a blatant double standard. Evolutionists are speaking out against Creationism, when it quite obviously isnt their field. there is no such thing as an objective party, only ever subjective and biased, you cant avoid it. how about focussing on the arguments at hand instead of targetting the source and attempting to discredit them (most, if not all with Ph.D's in their respective fields) simply because they dont believe what you choose to believe.

S.C. Watson
July 30th, 2005, 11:24 PM
'stoph - for the sake of claification, in essence, what you are driving at here is that you accept the idea of Microevolution, however, do not accept the concept of Macroevolution. Is this correct?

Or, are you holding that neither are valid? Or the reverse? Just to be clear.

S.C. Watson
July 30th, 2005, 11:29 PM
youre applying a blatant double standard. Evolutionists are speaking out against Creationism, when it quite obviously isnt their field. there is no such thing as an objective party, only ever subjective and biased, you cant avoid it. how about focussing on the arguments at hand instead of targetting the source and attempting to discredit them (most, if not all with Ph.D's in their respective fields) simply because they dont believe what you choose to believe.

Certainly, evolutionists are speaking out against Creationism and Intelligent Design. It's a proven fallacy. It's incorrect. It does not hold and is unprovable. There are vast amounts data that refute both concepts concretely yet both creationists and ID proponants continue to refuse to listen to reason.

I'm sorry 'stoph. It's not subjective. Quite the contrary. There's nothing personal about any of this.

If it could be shown that there is a creator, CONCLUSIVELY. If it could be shown that the earth is as young as creationists claim, or that there is IN FACT intelligent design going on, or had been going on, I'd accept it. Simple as that.

However, it can not be shown, and further, will not be shown, because the claims are in error and are based around the ideology of religious beliefs which have no basis in science. Therefore, I can not accept something that isn't true.

[edit] And, um, yes, creationism is most definately the field of evolutionists. I would venture to say that *evolution* is not the field of creationists, as it is science, not faith. Whereas the creationism's sole purpose, along with Intelligent Design, is a lementable attempt to refute evolution.

emily g
July 30th, 2005, 11:30 PM
Dr. Terry Mortenson puts it quite simply that "Amoeba DNA has no information for making hooves, hair, tails and eyes, but horse DNA does. Alligator DNA has no genetic information for producing feathers, hollow bones and one-way lung systems, but eagles do." your assumptions are incorrect in this case, im afraid.
This guy doesn't know what he's talking about. DNA is only made up of four bases: A, G, C, and T. All of life’s creatures are made up of different rearrangements of these four bases. What this means is that ANYTHING is possible. Any way you can think of to use and rearrange these bases, it is possible.

the endosymbiont theory is quite old hat. should have gone out with the 70's. old habits die hard, eh?
This theory is still valid.

so i couldnt gather every single mutation ever recorded and get an accurate, to-the-decimal figure, so sue me. basically, i chose the 99% to highlight the extreme impracticality of mutations.
You are correct that most mutations are not beneficial, however dfacto is correct in that given the astronomical numbers of mutations that occur, those that end up being beneficial still add up to quite a lot. This is to say nothing of mutations that are neither beneficial nor harmful, but just hang around until they end up being put to one use or another.

youre missing my point with this whole argument - yes, mutations can be seen as beneficial, BUT (and a stress again, there is a proviso) a mutation has NEVER been observed to add additional structure to the DNA. the only perceivable role of a mutation is to corrupt whatever is there to begin with.
If this is what your argument is hanging on, you are sunk, my friend. Many mutations are caused when mistakes or breakages happen in your DNA and your body repairs it incorrectly. Your body has several types of enzymes whose job it is to repair DNA. Some snip bases out, some add bases in, some swap an incorrect base for a correct one. If your repair enzymes don’t work properly, they could cut bases, swap bases, or ADD IN bases where they aren’t supposed to.

Also, you must consider transposons. These genes move or “jump” around the genome. Some types “cut and paste” themselves, but other types “COPY and paste” themselves. If they copy and paste themselves, they are making the genome larger than it already was – adding information!

As this (http://en.wikipedia.org/wiki/Transposon) wikipedia article makes clear right up front, transposons “cause mutations and change the amount of DNA in the genome.”

So your theory that mutations can never add additional structure to the DNA is incorrect.

emily

emily g
July 30th, 2005, 11:38 PM
LMAO

OUCH!

going to the club find a link later but i have both of the dvds here at my house which you can purchase at any discovery store the series is called ancient evidence and the episode I am referring to is Mysteries of the apostles-Revelation: The end of the World.
Heh, thanks for taking my criticisms in good spirit.:)

I have no doubt that you DID see it on the Discovery Channel--I just doubt the veracity of the conclusions. There are many, many alternate theories.

cheers,
emily

stoph
July 31st, 2005, 12:46 AM
'stoph - for the sake of claification, in essence, what you are driving at here is that you accept the idea of Microevolution, however, do not accept the concept of Macroevolution. Is this correct?

Or, are you holding that neither are valid? Or the reverse? Just to be clear.

youre right, i subscribe to microevolution, but not to macroevolution.

stoph
July 31st, 2005, 01:54 AM
This guy doesn't know what he's talking about. DNA is only made up of four bases: A, G, C, and T. All of life’s creatures are made up of different rearrangements of these four bases. What this means is that ANYTHING is possible. Any way you can think of to use and rearrange these bases, it is possible.

You are correct that most mutations are not beneficial, however dfacto is correct in that given the astronomical numbers of mutations that occur, those that end up being beneficial still add up to quite a lot. This is to say nothing of mutations that are neither beneficial nor harmful, but just hang around until they end up being put to one use or another.

If this is what your argument is hanging on, you are sunk, my friend. Many mutations are caused when mistakes or breakages happen in your DNA and your body repairs it incorrectly. Your body has several types of enzymes whose job it is to repair DNA. Some snip bases out, some add bases in, some swap an incorrect base for a correct one. If your repair enzymes don’t work properly, they could cut bases, swap bases, or ADD IN bases where they aren’t supposed to.

Also, you must consider transposons. These genes move or “jump” around the genome. Some types “cut and paste” themselves, but other types “COPY and paste” themselves. If they copy and paste themselves, they are making the genome larger than it already was – adding information!

As this (http://en.wikipedia.org/wiki/Transposon) wikipedia article makes clear right up front, transposons “cause mutations and change the amount of DNA in the genome.”

So your theory that mutations can never add additional structure to the DNA is incorrect.

emily

ok, perhaps a little more clarification is in order. mutations may lead to the alteration of an organisms DNA, but stating that an increase in the amount of DNA does not mean to say that there is an increase in working genetic information. yes, a fly may grow an extra set of wings, but thats nothing new to the fly, its always had wings, and a mutation could lead to the doubling of this trait. does it have the ability, the potential, to grow hooves? what about antlers? is it possible that any variant of fly DNA could come across the correct combination of genetic information?

stoph
July 31st, 2005, 02:06 AM
Certainly, evolutionists are speaking out against Creationism and Intelligent Design. It's a proven fallacy. It's incorrect. It does not hold and is unprovable. There are vast amounts data that refute both concepts concretely yet both creationists and ID proponants continue to refuse to listen to reason.


another double standard. if you cant prove it, how can you possibly disprove it? when did evolutionists suddenly hold every absolute and every formula that would once and for all prove there was no Greater Intelligence? nothing concrete, a lot of presuppositions grounded solely on other speculations. yes, theres evidence, but is secular science interpreting it with the correct, objective mindset? last i heard this was not the case. like i said earlier, young earth theorists have built a case that has not yet been cut down by old earth theorists. similarly, Creationism views the fossil record as evidence for a global flood (as in Genesis), whereas secularists view it as billions of accumulated, evolving organisms.

what made secular science the superior reasoning? are you implying that Creationists are devoid of rationallity or cognitive thought, simply because they choose to look past themselves and see something higher?



I'm sorry 'stoph. It's not subjective. Quite the contrary. There's nothing personal about any of this.

If it could be shown that there is a creator, CONCLUSIVELY. If it could be shown that the earth is as young as creationists claim, or that there is IN FACT intelligent design going on, or had been going on, I'd accept it. Simple as that.

However, it can not be shown, and further, will not be shown, because the claims are in error and are based around the ideology of religious beliefs which have no basis in science. Therefore, I can not accept something that isn't true.

[edit] And, um, yes, creationism is most definately the field of evolutionists. I would venture to say that *evolution* is not the field of creationists, as it is science, not faith. Whereas the creationism's sole purpose, along with Intelligent Design, is a lementable attempt to refute evolution.

youre not subjective? so youre saying that you were never conditioned to believe evolution as undeniable fact? that you were born in a bubble, away from stimuli, then presented the arguments from both camps at the same time to make your own assumptions? something tells me youre more subjective than you think. there is, after all, more than one side to the story.

Creationism is as grounded in science as evolution is. both take at least some element of belief in order to function, and id go as far to say that Creationism and secular science arent all that different. we share principles, there are things that are universally held to be true and based in fact. each have areas in which they differ. each have a right to exist.

emily g
July 31st, 2005, 03:20 AM
this has not been observed. EVER. if it has and i am mistaken, please correct me.
ok so i misspoke, i apologise. thanks for pointing out my errs, i assure you im not as "dumb" as that post suggests.
a mutation has NEVER been observed to add additional structure to the DNA.
ok, perhaps a little more clarification is in order.
'stoph, I think I may be seeing the beginnings of a trend in this conversation. This is a game called "moving the goalposts." Every time someone says something to counter you, you respond with, "No, that's not what I really meant . . ." and then you proceed to change your qualifications, definitions, etc.
Now, some of this back and forth is probably inevitable . . . I certainly appreciate your willingness to admit your mistake on a point . . . but perhaps you might want to think a little more before you rush in with a blanket statement.

In all sincerity, I think I know what you're after--you're after those really dramatic changes that seem to show something turning into a different kind of "animal," i.e. a rabbit turning into a horse or some such (at least this is what your most recent posts seem to be saying). I'll tell you right now that you won't find that kind of lateral transformation. That's not what macroevolution is about or says. Do two seemingly different types of animals have a common ancestor? They probably do. And I'll bet the fossil record supports it. That's what macroevolution is saying.

I'll respond more specifically to your most recent post to me later.
best,
emily

stoph
July 31st, 2005, 03:56 AM
erg.. youve made me look a fool :P youll note, however (i hope), that the last two quotes are as relevant as they were when i wrote them - they arent contradictions, the latter is merely a refined version of the former without compromise.

not that i will admit defeat, nor that ill say in any case that all of that was for naught, and i am not trying to make excuses here, but ive seriously cut my deadline in half for schoolwork because of this and i cant afford to put any more time into it at the moment (so much for not getting sucked in in the first place). by all means, continue, but i for one will be stepping out for a while.

thanks for the debate so far!

emily g
July 31st, 2005, 05:15 AM
Hahaha . . . thanks for your good humor.

We certainly don't want to distract you from your homework. :P
Come back later if you wish.

best,
emily

wassermelone
July 31st, 2005, 06:09 AM
erg.. youve made me look a fool :P youll note, however (i hope), that the last two quotes are as relevant as they were when i wrote them - they arent contradictions, the latter is merely a refined version of the former without compromise.

not that i will admit defeat, nor that ill say in any case that all of that was for naught, and i am not trying to make excuses here, but ive seriously cut my deadline in half for schoolwork because of this and i cant afford to put any more time into it at the moment (so much for not getting sucked in in the first place). by all means, continue, but i for one will be stepping out for a while.

thanks for the debate so far!

Schoolwork... pfft!

Solving the evolution/creationism debate is FAR more important. :blahblah:

dfacto
July 31st, 2005, 08:05 AM
"Amoeba DNA has no information for making hooves, hair, tails and eyes, but horse DNA does. Alligator DNA has no genetic information for producing feathers, hollow bones and one-way lung systems, but eagles do." your assumptions are incorrect in this case, im afraid.

Aside from emily's very clear slamdunk based on the structure of DNA, lets look at what my "assumptions" are.

Firstly, I believe that it has been proven that almost all of the genetic traits required for a drastic evolution are already contained within the human genome, and I would assume that the same applies to other animals. This means that the capactiy to become a whole different species, genus, etc (dunno how high up the ladder it goes) is built in and requires no mutation.

I stated, basically, that macroevolution is possible (which I then proved in another link), and I was simply unaware of how far those changes could mutate the animal. Last I checked, amoebas are in the kingdom Protista, whereas horses are in the animal kingdom. I did not state that horses could evolve into amoebas, or vice versa. I stated that horses could evolve into a new species, or a new genus, or maybe even further, based on their current DNA. This is quite enough to prove macroevolution is true, at least to a certain extent, and since that was the point of contention along with mutation, I see nothing wrong with what I said. In fact, you agreed with me:

splitting of the species or "speciation" as i have referred to previously is perfectly viable, and i have no argument against it.

And now to the definition that I posted:
macroevolution is used to refer to any evolutionary change at or above the level of species. It means the splitting of a species into two (speciation, or cladogenesis, from the Greek meaning "the origin of a branch") or the change of a species over time into another (anagenesis, not nowadays generally used). Any changes that occur at higher levels, such as the evolution of new families, phyla or genera, is also therefore macroevolution, but the term is not restricted to the origin of those higher taxa.

You'll excuse me if I don't use your definition, as it left out what macroevolution actually is, and focused on the controversy instead.

So, you agree with me, and macroevolution is then proven true, at least to a limited extent.

I think you need to more accurately define what you are arguing against, because you are shooting yourself in the foot at the moment, and then "moving the goalposts", as emily said.

the endosymbiont theory is quite old hat. should have gone out with the 70's. old habits die hard, eh?

Says who? Because biology still recognizes it as the truth, and it was in fact featured in a lecture in my Bio class last semester. You know, it probably has something to do with that pesky mitochondrial DNA and chloroplasts. In addition to that:

An endosymbiont is any organism that lives within the body or cells of another organism, i.e. forming an endosymbiosis (Greek: endo = inner and biosis = living). For instance, some nitrogen fixing bacteria (known as rhizobia) live in root nodules on legume roots, reef-building corals contain single-celled algae, and several insect species contain bacterial endosymbionts. Many other examples of endosymbiosis exist.
http://en.wikipedia.org/wiki/Endosymbiont

So why is it old hat again, and which creationist says so?

also, the 3 billion years you quote is also quite debateable, as young earth theorists have quite a case built (that im sure youve heard before.. or have you?).

Which one? I have run across a number of different theories, and all of them stank of bad science and ignorance of basic laws. So bad in fact, that a first year med student that is learning nothing about physics can refute some points based on basic high school material. But, if you want to reply to this in depth, please start a new thread. I'd rather that this thread stay on topic.

so i couldnt gather every single mutation ever recorded and get an accurate, to-the-decimal figure, so sue me. basically, i chose the 99% to highlight the extreme impracticality of mutations.

I'd have some choice words to say about this, but I've been guilty of the same, so it's cool. :rendered: However, even with that high improbability, there still exists a chance for a huge number of beneficial mutations, as I already said. You didn't have much to say about this aside from attacking endosymbiosis, so I'll just leave it at what I said, and the very solid reply that emily posted. Oh, but before I forget (from your post)

It should be noted that, contrary to science fiction, the overwhelming majority of mutations have no real effect.

You then said that that was what you had been saying all along. In which case, you have squarely kicked yourself in the nuts.

yes, mutations can be seen as beneficial, BUT (and a stress again, there is a proviso) a mutation has NEVER been observed to add additional structure to the DNA. the only perceivable role of a mutation is to corrupt whatever is there to begin with.

As emily said, you're sunk. New DNA can be added, chromosome segments can be swapped, doubled, removed, etc. This obviously won't immediately lead to a new DNA segment capable of adding a new trick to the animals genetic repertoire, BUT, think about the time involved and the number of mutations that can occur. A flip, a snip,a doubling, and some corruption could lead to new allelle over the course of a number of mutations spannig a number of generations. With 3 billions years worth of mutation, I'd be astonished if this sort of trait diversification wouldn't be rampant.

id say thats pretty much what ive been saying all along. are you going to dispute this?

your synopsis of microevolution was the same as mine. Your macroevolution was missing the actual definition, so I assume that you hold with the one that I posted, being that macroevolutionis evolution above the level of species. Your post on mutation kicks you in the nuts, as I already stated.

Mutations are considered the driving force of evolution, where less favorable (or deleterious) mutations are removed from the gene pool by natural selection, while more favorable (or beneficial) ones tend to accumulate. Neutral mutations do not affect the organism's chances of survival in its natural environment and can accumulate over time, which might result in what is known as punctuated equilibrium, the modern interpretation of classic evolutionary theory. It should be noted that, contrary to science fiction, the overwhelming majority of mutations have no real effect."


If this is what you've been saying all along, then I wholeheartedly agree! Though perhaps you worded that incorrectly.

you, on the other hand, have no interest in discussing mutations

If you are referring to my lack of a post as promised yesterday, then I have no good reply that doesn't sound like whining, but here I go anyways: My internet was down for the lat half of the day, and I need to complete a few sheets of weapon concepts for my contract job. That being said, I may not get it today either. If you were not referring to this, but rather to my lack of talk on mutation, then this post should satisfy that. I might have said more, but emily handled it very well already. No need to repeat.

youre fighting an uphill battle here. i must return to my work, i wait for a response.

Of course I am. Arguing against creationists is always an uphill battle because of the evasive nature of their arguments. You have
moved the goalposts" already which shows that this debate will most likely be exactly like the others. By all indications, you have destroyed a large part of your argument already (see above), and if you are the standard creationist, then we'll be seeing some very drastic and evasive damage control from you. I hope that isn't the case.

S.C. Watson
July 31st, 2005, 10:17 AM
youre right, i subscribe to microevolution, but not to macroevolution.

Interesting, because there would be no macroevolution without the cascade effect of microevolution.

figure2
July 31st, 2005, 10:44 AM
the only perceivable role of a mutation is to corrupt whatever is there to begin with.This is not true. The purpose of mutation is to allow an organism to adapt to a constantly changing environment, whether that be encroachment from competing organisms, a change in climate, or migration to a new environment that may be initially hostile. While it's true that many mutations do result in a corruption, this is because evolution doesn't always get it right on the 1st try. Over several generations, individuals within the organism's population may branch out into different types of mutations. Those branches of mutation that help the organism adapt to its new environment will survive and may go on to form a new sub-species. The less successful branches will die off.

By the way, the theory of The "Flying Spaghetti Monster" was not entirely rejected by the Kansas School Board. Here are 2 of their replies (http://www.venganza.org/response1.htm).

MoP
July 31st, 2005, 10:46 AM
If "intelligent design" is true, why do humans have appendixes? So God can give sinners appendicitis? :)

(Oh, and 'stoph, before you go and post this link (http://www.answersingenesis.org/docs2002/0718appendix.asp), read this section (2nd paragraph specifically) (http://www.talkorigins.org/faqs/vestiges/appendix.html#functions), and you will notice that the "evidence" that Answers in Genesis puts forward is actually outdated research from 1995 which has been disproven since 2000. Biases can always try to skew facts to fit their ideas.)

S.C. Watson
July 31st, 2005, 11:00 AM
another double standard. if you cant prove it, how can you possibly disprove it?

Have you ever heard of the argumet "There's a dragon in my garage"? It goes something like this: one person asserts something fantastic (they have a dragon in their garage). The other person is willing to believe them, provided that they supply some sort of physical evidence. The person making the assertations avoids all attempts at closer examination by making further fantastic claims and exhagerations that foil any attempt to pin down the dragon; it's invisible; its incorpreal, you can't measure on infrared, the instruments are mistaken, the scientists are mistaken, etc. etc.

At the end of the day, one is left with the question of whether or not there is a dragon in that person's garage. Nothing has been proven. There is no evidence of any sort.

The only conclusion left to make is that there really is no dragon. If one shred of evidence, real, hard physical, undeniable fact were shown - or a series of facts that locked together in such a way to support the claim, with each supporting the other, it wouldn't be a problem.

But, alas, it's not the case. And therefore a false claim. It can be disproven because all supporting evidence points in precisely the oppisite direction of what is claimed. Such is the case with Creationism and Intelligent Design. There is *no evidence* to support them, yet volumes full to the contrary.

when did evolutionists suddenly hold every absolute and every formula that would once and for all prove there was no Greater Intelligence?

That's not what I said. I said that there is no evidence for Intellegent Design or Creationism. Nothing to support the claims. There are no tell tale marks. No teeth cuts on the bone, so to speak.

The evolutionary record is a pretty smooth, fairly complete, one with gaps that are expected when you are dealing with millions of years, and frankly, in some cases billions of years. That is a bloody long time. However, the tell tale signs from one species to another are enough to conect one era, and one group to another. Some are so much so it's startling - see the skeletons on page 2 - the similarities are there because mammoth and sabertooth tiger are using the same base model for their physical structure, with some modifications for their species, as we are for ours. The forearm is an especially fun study, because almost every species that has limbs uses the same structure.

Why?

Because at some point, we *all* had a common ancestor.

I think this is the macroevolution part.


nothing concrete, a lot of presuppositions grounded solely on other speculations. yes, theres evidence, but is secular science interpreting it with the correct, objective mindset?

'stoph, let me ask you something; have you ever had to take medicine for an illness? go to the hospital? did *secular science* do what it was supposed to do?

I'd dare say that your "secular science" is far more objective than your non-secular theological groups.

last i heard this was not the case. like i said earlier, young earth theorists have built a case that has not yet been cut down by old earth theorists.

That's because they either don't understand what is in front of them, or they are working awfully hard to further their agenda. And believe me, the stakes are high to disprove science, my friend.

similarly, Creationism views the fossil record as evidence for a global flood (as in Genesis), whereas secularists view it as billions of accumulated, evolving organisms.

See above.

what made secular science the superior reasoning?

Because it is *objective*, and not attempting to push an agenda.


are you implying that Creationists are devoid of rationallity or cognitive thought, simply because they choose to look past themselves and see something higher?

No. I'm saying that the people that are driving the argument, that instituted the concept of creationism and intelligent design have an agenda to drive a wedge between science and masses because evolution is the one single thing thing that can undo them.

Both creatinism and intelligent design are fairly new concepts - with intelligent design being pulled together from the failed attempts of creationism during the 90's - the concept itself has evolved over the years to become something larger than what it was when it was first purposed during the late 80's and early 90's.

To me, whom you claim as subjective, I see a much larger power play going - one for the minds and money (it's mostly about money if you ask me, but that's a little cynical...) of the people who genuinely believe in god and are good people just trying to live their lives as best they can. If a wedge can be driven between them and science - good. because at it's core, what does science teach? It teaches us to qeustion things. Take nothing for granted. Look for the proof.

This is very threatennig to any religious organization, because at their core what do they teach? Don't question, accept what you are told, you don't need proof, you need to believe.

It's turned into a conflict of ideologies.

*sigh* - I don't go into these discussions looking to disprove the concept of god. I merely look to correct the science, and the process with which the conclusions are made. At the end of the day, if you want to believe in something intangible, that is your choice. But at least along the way, let's look at things clearly and without someone else's agenda getting in the way.

youre not subjective? so youre saying that you were never conditioned to believe evolution as undeniable fact?

Yes. I came to these conclusions on my own after many, many years of personal turmoil and struggle where-in I compared what I was told by my pastors, preachers and parents to science and found the former lacking. They couldn't answer the questions that I had. However, science was able to. And in the few instances where it was not, someone was actively working on an answer.

that you were born in a bubble, away from stimuli, then presented the arguments from both camps at the same time to make your own assumptions?

Who's being subjective now? :teeth: That's a personal attack, my friend and has no business here.

something tells me youre more subjective than you think. there is, after all, more than one side to the story.

Certainly. And I just gave it to you a paragraph or so up.

Creationism is as grounded in science as evolution is.

No. Creationism is grounded in agenda which attempts to cloak itself in science. The fit is poor and frankly an embarrasment to those who unselfishly believe in their religions.
both take at least some element of belief in order to function,

No. Belief is subjective and is coloured by ideals which are provided by preconcieved notions.

There is no belief is science. Science can not support something that is belief based because the moment that it does it is no longer science. Science only concerns itself with what is, has been and what has the realistic possibility of being based upon the criteria of the previous two parameters.

and id go as far to say that Creationism and secular science arent all that different.

I would say that they are worlds apart.

we share principles, there are things that are universally held to be true and based in fact.

which were provided to creationists by science.

each have areas in which they differ. each have a right to exist.
Certainly. However, one is mistaken and a tool used for questionable purposes.

Ssenkrah Semaj
July 31st, 2005, 11:37 AM
Wow the wealth of information being displayed here by stoph, emily g, oregano, mop , etc, etc is astounding, my knowledge of evolution at best was general but this thread is very, very informative on both sides of the argument. I don't see why people complain about threads like this even if no one admits the other being plausible we still are all learning alot from the conversation.

0kelvin
July 31st, 2005, 02:59 PM
Oregano is my hero.

I'm exerting all the self control I have to not join the discussion (they always end up taking up way too much time I should be using toward my Thunderdome entry), but luckily Oregano and emily g are making it much easier by saying everything I wanted to say anyway! You go guys!



0kelvin

Ssenkrah Semaj
July 31st, 2005, 04:06 PM
Originally Posted by Ssenkrah Semaj
Actually since the discovery of the dead sea scrolls and their translation it has been revealed that the devils number is actually 616 in revelations, it was mistranslated...-as reported on the Discovery Channel.

Also they believe the reason why that is his number is because of an ancient hebrew name game where letters were assigned numerical value. John gives references to a 7 headed dragon while he was exiled on an island by the roman empire which at that time had 7 major cities. Who was the emperor of rome during that time and who's name coincidentally equals the value of 616? The infamous Caligula.

sorry just had to share that with everyone.

Ahh, Semaj, I appreciate you trying to share some interesting facts, but I'm afraid I just can't trust what you say when it comes to interpreting scripture! :) (I know, I know, you saw it on the Discovery Channel, etc., etc. . . . Provide me with a link, please. :))

You have an uncanny ability to misinterpret what you read and/or you report dubious information on this subject (the whole YHWH thing . . .).

I am well aware of the symbolic significance of numbers used by John in Revelation, but I believe the whole 666 (or 616) = "name of some evil person here" interpretation is off the mark.

With that said, I think this is my favorite post of yours ever:

hahaha
emily

Make fun of me will you! Say i misinterpret the bible do I? Fools i'm the only one who gets it!

Here are just a few links I found to support my previous statement;
http://www.aymnetwork.com/node/1011
http://spaces.msn.com/members/zerocoolarunav/
http://www.historicist.com/horae4/appendix2-1-1.htm

As a matter of fact if you google the phrase "devils number 616 roman emperor caligula" there are numerous sites soooooo :P

Prometheus|ANJ
July 31st, 2005, 04:17 PM
I heard about 616 the other day too (on discovery). It's the number of Gaius Ceasar (Kaiser) (aka. Calligula) (who put a statue of himself in one of their temples), whilst 666 is the number of Nero. I suppose you can make a lot of names into that number though.
They also mentioned on the program that Harmageddon is the plains or something nearby, where the infamous 7th (?) legion had it's camp. Johannes himself thought he was living in the end times, as did most of the 'prophets'.


This one just came outta my head. I don't know what it means.
http://web.telia.com/~u48508900/troll.jpg

dfacto
July 31st, 2005, 04:26 PM
Fishing for suckers?

Ssenkrah Semaj
July 31st, 2005, 04:44 PM
Johannes himself thought he was living in the end times, as did most of the 'prophets'.


Preach it brother!

Prometheus|ANJ
July 31st, 2005, 05:11 PM
Nono dfacto, that's too bluntly put. If he's fishing then he exists, and then they aren't suckers for buying it. I think it suggests something about the morals of god, or his methods. Who knows, the drawing is pretty pseudodeep. I just found it appealing to put a hook on the cross. 'Jesus Saves!' and all that. You just need to bite.

Regarding prophets and other topics (click colored links to the right)

Sceptics Annotated Bible (http://www.skepticsannotatedbible.com/)

dfacto
July 31st, 2005, 05:18 PM
I would call fish suckers for falling for bait. No matter if there is a fisherman or not. If God is baiting people, those that fall for it are still suckers, even if he is using himself as part of the bait.

Dunno, that's how I see it.

WindWalker
July 31st, 2005, 05:30 PM
I'd reply to more than this, but I'm this topic is starting to bore me.

If "intelligent design" is true, why do humans have appendixes? So God can give sinners appendicitis? :)
Actually, your appendix, while not vital, supposedly does play a part in digestion. Ask your doctor.

EDIT: Side note on the subject. I wonder...could our appendix have once been quite useful, but rendered nearly useless by genetic mutation? What I question is, is that evolution, or devolution? Suppose we won't know til A.)millions and millions of years pass, or B.)the world goes 'splodey and we stand before the Judgement Seat.

Both creatinism and intelligent design are fairly new concepts - with intelligent design being pulled together from the failed attempts of creationism during the 90's - the concept itself has evolved over the years to become something larger than what it was when it was first purposed during the late 80's and early 90's.
Huh? It's become more controversial, yes, but it's not a new concept. People have just gotten more obsessed with the politics of it all.

It's like how child abuse was sort of glossed over early last century, and now people are all sayin', "You should NEVER spank your children! It'll squelch their personality!" It wasn't that abuse didn't happen, people just didn't talk about it.

wassermelone
July 31st, 2005, 05:59 PM
Actually, your appendix, while not vital, supposedly does play a part in digestion. Ask your doctor.

I don't think it was ever called useless except by the creationists saying scientists had. Its funny because they say stuff like "the apparent uselessness of vestigial organs..."

ves·tig·i·al (v-stj-l, -stjl)
adj.

Occurring or persisting as a rudimentary or degenerate structure.

Neither rudimentary or degenerate means useless.

Oregano:
Intelligent Design isn't new. Its something that Ben Franklin ascribed to. They used a whole lot of watchmaker analogies.

dfacto
July 31st, 2005, 06:02 PM
EDIT: Side note on the subject. I wonder...could our appendix have once been quite useful, but rendered nearly useless by genetic mutation? What I question is, is that evolution, or devolution? Suppose we won't know til A.)millions and millions of years pass, or B.)the world goes 'splodey and we stand before the Judgement Seat.

I had a talk about that with one of my anatomy professors actually. The leading theory is that it is the remnant of the larger Caecum (intestinal segment) that herbivores have. When our ancestors split from the herbivore lines way way back, the diet changed, and the large caecum became useless. It shrunk down, and nothing was left of the larger mass except for an appendix dangling from the base of the human sized caecum. Either that or there was another intestinal segment which became the appendix and not the caecum itself which shrunk. I haven't done much (read: any) real research on it, since it's rather unimportant for anatomical purposes and it's also just not all that interesting. I suppose I should though.

As for the function of the appendix, it's rather vague. As a part of the intestinal system, it's not much use in actually digesting food. It is, in fact, rather bad for particles to get into it, since a blockage of it's entrance leads to appendicitis. The organ is, however, rich in lymphatic tissue, and is therefore useful as an immune organ. However, this is rather unimportant, because the intestine already has lymphatic tissue in it, meaning that the appendix is not vital in any way. It isn't vital for any other bodily function either, although it may aid some processes, such as properly forming the immune response. However, the Thymus, for example, already does that just fine, so the appendix has no specialized purpose. Aside from that, as far as I know, having it removed has no ill effects.

I'd say all of that adds up to a vestigial organ.

EDIT:

I don't think it was ever called useless except by the creationists saying scientists had. Its funny because they say stuff like "the apparent uselessness of vestigial organs..."

Probably right. The appendix is clearly not useless, as it does have lymphatic tissue in it, and does DO something. However, it's not necessary. As far as I know, it can be removed without any problems whatsoever, aside from the complications that can occur during the surgery.

S.C. Watson
July 31st, 2005, 06:49 PM
Huh? It's become more controversial, yes, but it's not a new concept. People have just gotten more obsessed with the politics of it all.

It's like how child abuse was sort of glossed over early last century, and now people are all sayin', "You should NEVER spank your children! It'll squelch their personality!" It wasn't that abuse didn't happen, people just didn't talk about it.

Point conceeded. To a point :P Intelligent Design *is* however a new packaging of the same ideology, with some tweaks. My comments were specifically refering to creationist attempt to have it taught in school during the mid 90's, which ended badly for the creationists. Intelligent Design was coined either late 90's or early 00's and is responsible for the current case in Kansas (second one, I believe, since 2000).

I did some research on Creationism and wasn't able to locate a date when the concept was first brought forth - actually, there seems to be some confusion about that, which I found interesting. Even Wikipedia is debating that here (http://en.wikipedia.org/wiki/Talk:Creationism/History_of_Creationism) .

Also, for anyone who's interested, here's a link to the Scopes Monkey Trial (http://www.law.umkc.edu/faculty/projects/ftrials/scopes/scopes.htm) which I came across looking for info on the beginnings of creationism.

My opinion is that creationism in it's current form, more or less, is probably a reaction to Darwin. But if I find something to solidly contradict that, I'll post it.

S.C. Watson
July 31st, 2005, 06:51 PM
Oregano:
Intelligent Design isn't new. Its something that Ben Franklin ascribed to. They used a whole lot of watchmaker analogies.

meaning the clock work universe?

Can you shoot me a link on that - I've seriously never heard of much less seen the term "Intelligent Design" before 2000, and what I have heard/read was that it was an out growth and modification of creationism.

Thanks.
~S

S.C. Watson
July 31st, 2005, 06:55 PM
From Wikipedia:
Origin of the Term:
The phrase "intelligent design", used in this sense, first appeared in Christian creationist literature, including the textbook Of Pandas and People (Haughton Publishing Company, Dallas, 1989). The term was promoted more broadly by the retired legal scholar Phillip E. Johnson following his 1991 book Darwin on Trial. Johnson is the program advisor of the Center for Science and Culture and is considered the father of the intelligent design movement.
------------
History of the concept of creation

The history of creationism is tied to the history of religions. Creationism in the West primarily had some of its earliest roots in Judaism. For example, Ibn Ezra's (c. 1089–1164) commentary on Genesis is greatly esteemed in traditional rabbinical circles and he was a creationist. Also, when one looks at the early Church the majority view was the creationist view as shown by a work by Robert I. Bradshaw given in the article section below.

In the 18th and 19th centuries, Christians found their accounts of creation to be in conflict with empirical observations of natural history from scientific inquiry. While the term creationism was not in common use before the late 19th century, creationists consider their primary source to be the ancient Hebrew text describing creation according to Genesis and see themselves as being the philosophical and religious offspring of the traditions that held that text sacred. The biblical account of history, cosmology and natural history was believed by Jews, Christians and Muslims and its accuracy was unquestioned through the Medieval period. Most people in Europe, the middle east and other areas of the Islamic world believed that a supreme being had existed and would exist eternally, and that everything else in existence had been created by this supreme being, known variously as God, Yahweh, or Allah. This belief was based on the authority of Genesis, the Qu'ran, and other ancient histories, which were held to be historically accurate and no systematic or scientific inquiry was made into the validity of the text.

emily g
July 31st, 2005, 08:56 PM
Make fun of me will you! Say i misinterpret the bible do I? Fools i'm the only one who gets it!
Heh, like I said, I have no doubt that you saw it. I just object to you reporting as if it were fact (more the interpretation part rather than the actual number part).

Many people assume that John means us to use the number/letter game (gematria) because he tells us to “calculate” the number of the beast. But the alternative (and seemingly more common) translation is just to “count” or “notice” the number of the beast.

John uses numbers symbolically over and over again throughout Revelation, but no where else does he use gematria. This suggests that 666 is symbolic as well, rather than a code. A common interpretation is that because the number 7 represents perfection, the number 6 represents falseness, i.e. less than perfection. 616 doesn’t work quite as well for this as 666 does, though.

I didn’t mean to start a tangent with my joke, but I suppose I wouldn’t have got riled up if you hadn’t posted in such a “this is what it means” manner.

I have just noticed that you often post scriptural interpretations of your own and seem to refuse to acknowledge (or be aware of) alternate and equally valid interpretations.

Plus, I find the whole 666/616 = so-and-so game pretty useless since you can make almost anything add up to these numbers.

emily

CaptainInsano
July 31st, 2005, 09:22 PM
everyone!

Big Bird has a message for you!


http://img.photobucket.com/albums/v678/ParkerD/bigbird.jpg

WindWalker
July 31st, 2005, 09:24 PM
Heh, like I said, I have no doubt that you saw it. I just object to you reporting as if it were fact (more the interpretation part rather than the actual number part).

Many people assume that John means us to use the number/letter game (gematria) because he tells us to “calculate” the number of the beast. But the alternative (and seemingly more common) translation is just to “count” or “notice” the number of the beast.

John uses numbers symbolically over and over again throughout Revelation, but no where else does he use gematria. This suggests that 666 is symbolic as well, rather than a code. A common interpretation is that because the number 7 represents perfection, the number 6 represents falseness, i.e. less than perfection. 616 doesn’t work quite as well for this as 666 does, though.

I didn’t mean to start a tangent with my joke, but I suppose I wouldn’t have got riled up if you hadn’t posted in such a “this is what it means” manner.

I have just noticed that you often post scriptural interpretations of your own and seem to refuse to acknowledge (or be aware of) alternate and equally valid interpretations.

Plus, I find the whole 666/616 = so-and-so game pretty useless since you can make almost anything add up to these numbers.

emily
Ah, you know, a few friends of mine took a couple classes in western religion. Supposedly, and I'll have to do further research before claiming it as fact, the number 666 was not truly intended to be a number. Rather, it is similar to the tetragrammon, I believe. It was a sort of misunderstanding of the writer's intentions, and was meant to be the Devil(?)'s name, or part of it anyways.

As I said, I'll have to ask around and do some research of the Greek texts to see if that has any factual basis.

WindWalker
July 31st, 2005, 09:33 PM
Point conceeded. To a point :P Intelligent Design *is* however a new packaging of the same ideology, with some tweaks. My comments were specifically refering to creationist attempt to have it taught in school during the mid 90's, which ended badly for the creationists. Intelligent Design was coined either late 90's or early 00's and is responsible for the current case in Kansas (second one, I believe, since 2000).

I did some research on Creationism and wasn't able to locate a date when the concept was first brought forth - actually, there seems to be some confusion about that, which I found interesting. Even Wikipedia is debating that here (http://en.wikipedia.org/wiki/Talk:Creationism/History_of_Creationism) .

Also, for anyone who's interested, here's a link to the Scopes Monkey Trial (http://www.law.umkc.edu/faculty/projects/ftrials/scopes/scopes.htm) which I came across looking for info on the beginnings of creationism.

My opinion is that creationism in it's current form, more or less, is probably a reaction to Darwin. But if I find something to solidly contradict that, I'll post it.
Ah, I must also concede to your point. It has indeed become Creationism in a shiny new box, "new and improved!", if you will. Not sure exactly why, but that kinda thing pisses me off.

EDIT: ParkerD...I can only hope to someday be as mature as you.

/sarcasm

S.C. Watson
July 31st, 2005, 09:42 PM
everyone!

Big Bird has a message for you!


http://img.photobucket.com/albums/v678/ParkerD/bigbird.jpg

Let's presume that *you* took the photo for a moment since you posted it. For the sake of argument I don't think the Big B was flipping us off, now was he? :perv:

S.C. Watson
July 31st, 2005, 09:43 PM
Ah, I must also concede to your point. It has indeed become Creationism in a shiny new box, "new and improved!", if you will. Not sure exactly why, but that kinda thing pisses me off.

Interesting how all this works in the background, isn't it?

figure2
July 31st, 2005, 09:47 PM
Personally, I would have no objection to creationism & Intellegent design if it included the creationist theories of every known religion and was taught as part of the social studies curriculum. This would be an interesting study on comparitive cultures & religions. Since the conservative Christians who are promoting these ideas have a lot of inherent bigotry toward cultures and religions who don't believe as they do, this is unlikely to happen.

WindWalker
July 31st, 2005, 09:56 PM
Interesting how all this works in the background, isn't it?
Facinating. ;)

Personally, I would have no objection to creationism & Intellegent design if it included the creationist theories of every known religion and was taught as part of the social studies curriculum. This would be an interesting study on comparitive cultures & religions. Since the conservative Christians who are promoting these ideas have a lot of inherent bigotry toward cultures and religions who don't believe as they do, this is unlikely to happen.
Ah, yes. That is exactly what I meant when I said that theories of evolution and "intelligent design" should be taught together. Kids today know almost nothing about other cultures except for a few vague stereotypes they see on TV. I think it would be an enriching experience for all, and I believe society as a whole would most likely benefit from it.

EDIT: And may I also point out, for the record, that not all conservative Christians are total bigots, although unfortunately, many are. I consider myself to be a very conservative (not extreme right-wing, but sorta in the middle) Christian, but I would encourage learning about other cultures and belief systems. If anything, it would encourage diversity (variety is the spice of life!) and tolerance. (Another re-packaged term, but I won't get into that.)

CaptainInsano
July 31st, 2005, 10:18 PM
Let's presume that *you* took the photo for a moment since you posted it. For the sake of argument I don't think the Big B was flipping us off, now was he? :perv:

LOL! you got me :tihi:

S.C. Watson
July 31st, 2005, 10:48 PM
Personally, I would have no objection to creationism & Intellegent design if it included the creationist theories of every known religion and was taught as part of the social studies curriculum. This would be an interesting study on comparitive cultures & religions.

That would be an awesome class. I'd take something like that in a heartbeat.
Since the conservative Christians who are promoting these ideas have a lot of inherent bigotry toward cultures and religions who don't believe as they do, this is unlikely to happen.

Well, in reality, if you have any social studies class or cultural anthropological class worth its merit, it will be taught. However, not in middle school or high school, which seems to be the battle ground for all of this non-sense...

MoP
July 31st, 2005, 10:55 PM
The USA should do what all the government-run schools in the UK do - teach science as science, and have a separate class (usually called Religious Studies) for learning about all the interesting beliefs of varying religions.

It only makes sense to keep the facts separate from the faith.

WindWalker
July 31st, 2005, 11:12 PM
Wow the wealth of information being displayed here by stoph, emily g, oregano, mop , etc, etc is astounding, my knowledge of evolution at best was general but this thread is very, very informative on both sides of the argument. I don't see why people complain about threads like this even if no one admits the other being plausible we still are all learning alot from the conversation.
Seems I missed this post. Yes, I wholeheartedly agree. It is quite informative for both sides of the issue. And I must say, I'm pleasantly surprised this has stayed so civil and mature (for the most part anyways). It's nice to see that some people can have decent debates without everyone bickering and flaming each other. The reason everyone complains about threads like these is the fact that most do get ugly rather quickly. I'm quite impressed with this one, though. :)

It is my hope that people reading this thread who don't really know which to believe take a good look at both sides and make an informed decision based on their own private research, rather than just blindly picking one. After all, how can you believe something if you don't know what it is you believe?

figure2
July 31st, 2005, 11:33 PM
And may I also point out, for the record, that not all conservative Christians are total bigotsWindWalker,

I was hardly suggesting that all conservative Christians were bigots but I do believe that tose with a political agenda to impose their ideas on everyone are more likely to be.

S.C. Watson
July 31st, 2005, 11:37 PM
LOL! you got me :tihi:


haha :P

REEF
July 31st, 2005, 11:52 PM
Think someone needs to submit a better representation of his Tangledness. The picture does not do him justice.

Ssenkrah Semaj
August 1st, 2005, 12:03 AM
Heh, like I said, I have no doubt that you saw it. I just object to you reporting as if it were fact (more the interpretation part rather than the actual number part).

Many people assume that John means us to use the number/letter game (gematria) because he tells us to “calculate” the number of the beast. But the alternative (and seemingly more common) translation is just to “count” or “notice” the number of the beast.

John uses numbers symbolically over and over again throughout Revelation, but no where else does he use gematria. This suggests that 666 is symbolic as well, rather than a code. A common interpretation is that because the number 7 represents perfection, the number 6 represents falseness, i.e. less than perfection. 616 doesn’t work quite as well for this as 666 does, though.
That would make a valid argument if the new evidence from the translation of the discovered dead sea scrolls did not reveal the number to be 616 and that exactly why the new theory of gematria works.

I didn’t mean to start a tangent with my joke, but I suppose I wouldn’t have got riled up if you hadn’t posted in such a “this is what it means” manner.

I have just noticed that you often post scriptural interpretations of your own and seem to refuse to acknowledge (or be aware of) alternate and equally valid interpretations.

Your Mother!

Plus, I find the whole 666/616 = so-and-so game pretty useless since you can make almost anything add up to these numbers.

emily

aaaaaand if that were the case then why would John say it is a "human" number he is letting the reader know that there is a significance to the number and that a real person was behind it. John could not simply give the name Caligulia he had to write in code when he was writting to the churches for he was exiled on an island.

WindWalker
August 1st, 2005, 12:15 AM
WindWalker,

I was hardly suggesting that all conservative Christians were bigots but I do believe that tose with a political agenda to impose their ideas on everyone are more likely to be.
Oh, I wasn't trying to say you were. I really should be more specific. I was saying that in general as a reminder to...feeble minds, shall we say?...who might also read this and be quick to buy into stereotypes. In every political/religious group, there are usually many bigots, but there are always exceptions that people often forget about. I strive to be one of those exceptions. :) That's all I was saying.

EDIT: This is totaly unrelated, but has anyone else heard about how astronomers have (finally) discovered a 10th planet? Sounds like some interesting stuff. I don't particularly know much about astronomy, but I wonder. How is it we know exactly what some galaxy's look like, but we can't see our own planetary system? I'm sure there's a reasonable explanation, I guess I don't know enough about the subject. Or it's just getting late and my brain has finally shut down for the night. Any astronomy buffs here?

REEF
August 1st, 2005, 12:22 AM
Ever since I read Da vinci code (like the conforming bastard I am)

Christianities beginning made me kinda ehh.. question it

dogyears
August 1st, 2005, 01:14 AM
Ever since I read Da vinci code (like the conforming bastard I am)

Christianities beginning made me kinda ehh.. question it

hahaha ... that has got to be the cliche of the year.

Prometheus|ANJ
August 1st, 2005, 02:26 AM
Answer to the 10th planet question:

A Planet X has been rumored to exist for quite a while. Some think it's a earthlike planet in a very excentric orbit or something larger very far out. What they found in this case was just a little rock (about 3000km in diameter I think).

It's debateable whether it's a planet or not. Since Pluto is a Planet (atm.) and this new one is one notch larger than Pluto (the two others they found wasn't) they call it Planet X (X=10), or possibly Xena... which sounds a bit cheesy (maybe it's a joke?) but the geek in me likes it.

Anyways, these 'planets' or minor planets or kupier belt objects are tiny compared to 'regular planets'. They're also in strange orbits (not where you expect to find planets), and very far away. All that combined makes them very hard to find.

stoph
August 1st, 2005, 02:52 AM
Haha this is getting waaay out of hand, and I think people are getting a little too offended and offensive at the moment. I’ll respond to what I can at the moment, but I think its safe to say that this is a cyclic argument that will continue on in this fashion (always seems to be the case).

As I am strapped for time, I’ll try and group together similarly geared arguments and respond to them with (what will hopefully be) broad enough answers. Hope nobody has a problem with this.

”So, you agree with me, and macroevolution is then proven true, at least to a limited extent.”

“Interesting, because there would be no macroevolution without the cascade effect of microevolution.”


Yes, to an extent, evolution (in specific faucets) is perfectly agreeable, as it is observable and consistent (in those specific areas). What I do not subscribe to, and what is the basis for the neo-Darwinian theory is, and I’ll quote Dr Lee Spetner on this one – "[that] all life descended with modification from a putative single primitive source."

Mutations are the crux of the NDT, and the occurrence and effect of these mutations are random. Mutations, as has been discussed previously, alter the genome of the organism, either doubling or cutting-and-pasting, or emitting certain genetic details altogether. They can lead to a beneficial change (given the organism’s circumstance) or (as is observed more frequently), an undesirable change.

For all life to come from a single source, there must have been many multiple series of beneficial mutations within that particular genetic strain. Each subsequent mutation must have built on the previous mutation to allow a shift from the norm. This implies that through mutation there is an increase in overall complexity of DNA. This falls back to my notation (prompted by emily g) that the doubling of a genetic detail will not constitute for an increase in complexity, as it was always within the organism’s capacity to have that trait doubled in the first place. Complexity is key, here, and I know I sound like a broken record, but I’ll push this as far as I feel is necessary. When a mutation occurs in an organism, it either reduces, or mirrors the current level of complexity in the genetic structure. A fly with two sets of wings is not more complex; it is simply a jaded version of its parents. Is it a logical progression for a human being to have descended (not directly, of course) from a less complex organism such as a single-celled amoeba?

I’ll quote Spetner again at this point. He notes “The chain [of mutations] must be continuous in that at each stage a change of a single base pair somewhere in the genome can lead to a more adaptive organism in some environmental context. The concept of the adaptive landscape is useful here. This concept was first introduced by Sewall Wright, but now nucleotide sequences of the mean population genome have taken the place of Wright’s gene combinations. There are a great many adaptive hills of various heights spread over the genomic landscape. NDT then says that it should be possible to continue to climb an “adaptive” hill to a large global maximum (or near-maximum), one base change at a time, without getting hung up on a small local maximum. No one has ever shown this to be possible.”

Phew! That was long winded. Sorry. Ok, moving on.


This is not true. The purpose of mutation is to allow an organism to adapt to a constantly changing environment, whether that be encroachment from competing organisms, a change in climate, or migration to a new environment that may be initially hostile. While it's true that many mutations do result in a corruption, this is because evolution doesn't always get it right on the 1st try. Over several generations, individuals within the organism's population may branch out into different types of mutations. Those branches of mutation that help the organism adapt to its new environment will survive and may go on to form a new sub-species. The less successful branches will die off.

Oh, but you’ll find that it is. Mutations are (by definition) errors within the genetic structure. They corrupt (also synonymous with “alter” or “change”) the original combination of genetic information (which, in Creationist terms would have once been considered “perfect”). You’ve merely expanded on my original point, which is fine by me as it echoes what I have been saying all along. Thanks for the input into this tangent, however.


your synopsis of microevolution was the same as mine. Your macroevolution was missing the actual definition, so I assume that you hold with the one that I posted, being that macroevolution is evolution above the level of species. Your post on mutation kicks you in the nuts, as I already stated.

My speel on macroevolution was an overview, not a definition (which was stated clearly). I chose to highlight the fact that macroevolution is disputed within the secular scientific community and not just some exclusive little notion held by Creationists. Like I said, I was not attempting to supply a definition. Thanks for posting one all the same. You also asked about my objections to the endosymboint process. Please read on and I’ll explain myself.

Earlier I said that the use of endosymbiont occurrence in evolutionary arguments was outdated, but failed to provide any of my sources to justify this claim. I apologise, and now I’ll refer to Dr Aw Swee-Eng’s notes, where he concludes (in relation to the origins of life in which the endosymbiont process was credited with early life models) that “the Earth’s early atmosphere before 3.5 Ga could have significant quantities of oxygen. This should discourage the sort of hypothesising on abiotic monomer and polymer syntheses so often assumed to have occurred in Archaean times.”

Later, he refers to the process again, saying “The existence of chaperones influences the endosymbiont hypothesis of the origin of eukaryotes. This hypothesis proposes that chloroplasts and mitochondria began as free-living aerobic prokaryote ancestors which were engulfed by, and formed, a mutually advantageous relationship with an ancient large anaerobic prokaryote with a nucleus. These endosymbionts became the organelles mentioned, which then apparently lost many of their own genes to the nuclei of their hosts. Now, the timeframe of oxygen levels in the primitive Earth [see previous quote] is extremely controversial in the face of conflicting palaeobiological evidence. Nevertheless, how a stable relationship between ingested aerobic invaders and an anaerobic, or aerotolerant, host was possible, and why some genes and not others should be transferred to the host’s nucleus is not clear.”

I also apologise if that was a little too much to take in.

Sorry, Oregano old pal, I haven’t got the time at the moment to address your comments, so I hope you don’t mind if I leave them till a later post (if you want response at all, please indicate your preference).

jetpack42
August 1st, 2005, 03:08 AM
this is a cyclic argument that will continue on in this fashion

can't say you weren't warned.

stoph
August 1st, 2005, 03:12 AM
haha no, you were right. and i knew it to begin with, but i cant help myself sometimes. oh and im glad youre enjoying this, Ssenkrah Semaj.

heyyy.. anyone notice that im debating with no less than four others at one time? i am a mere mortal, this shouldnt be happening :P

emily g
August 1st, 2005, 03:36 AM
Semaj, you dare tangle with me on scriptural interpretation?! You will lose, my brother!

That would make a valid argument if the new evidence from the translation of the discovered dead sea scrolls did not reveal the number to be 616 and that exactly why the new theory of gematria works.
That would make a valid argument if this manuscript fragment conclusively proved that the number was meant to be 616. It does not.

[Note: this alternate translation comes from the Oxyrhynchus Papyri--NOT from the Dead Sea Scrolls. Oxyrhynchus is in Egypt, which is decidedly not on the shore of the Dead Sea. And “new theory of gematria?” It’s not a new theory. I assume you mean "new interpretation."]

Quote from this (http://www.catholicintl.com/noncatholicissues/666.htm) website:
World Net Daily cites Ellen Aitken, a professor of early Christian history at McGill University, and David Parker, professor of New Testament Textual Criticism and Paleography at the University of Birmingham in England, as its authority on the subject. Aitken goes so far as to say that 616 is the correct number, while Parker attempts to give the reason why. Both are incorrect assessments of the evidence, as we shall see. . . .

Although it is true that a “616” textual variant for Apocalypse 13:18 exists, this has been known for quite some time. In fact, it has been known by modern exegetes for at least two hundred years, since the art of textual criticism came into vogue. The truth is, the evidence for 616 is negligible, even with the additional papyri evidence touted by David Parker and Ellen Aitken.

The number 666 also has papyri evidence to back up its superiority. It comes from the famous Chester Beatty collection, Papyrus 47, which dates from the second century A.D. Its papyri pedigree is thus older than 616, since 616's evidence originates from the third or fourth century papyri, also known as Oxyrhynchus Papyri, specifically, Papyrus 115 for the Apocalypse. As such, Papyrus 115 does not add much to the issue, except to confirm the existence of 616 as a variant text. Irenaeus, who died just a few years after the second century, rejected 616 as a scribal error (See Against Heresies 5, 30, 1).

The Greek reading for 666, “exakosioi exekonta ex” (600 + 60 + 6), not only has the oldest pedigree but also has the most prominent and numerous textual evidences and witnesses. Papyrus 47, Codices Sinaiticus and Alexandrinus (fourth-fifth century), as well as P, 046, 051, 1, 94, 1006 (and 13 other minuscules); with witness such as Irenaeus, Hippolytus, Origen, Victorinus-Pettau, Gregory-Elvira, Primasius, Andrew and Arethas, all follow the reading “666.”

Only Codex C (fifth century) and one unknown manuscript from Irenaeus and Tyconius have “616,” as translated from the Greek “exakosioi deka ex” (600 + 10 + 6). Hence, 616 has hardly any convincing evidence to its reliability.

There is some more info discussing the gematria on the site.

From this (http://www.escapeallthesethings.com/666-616-number-mark-of-the-beast.htm) website:
So, if you did not know better, you might already be heading to your Bible with a red marker to cross out the 666 and write in 616. After all, we have an textual critic of the New Testament telling us 666 is wrong. But not so fast! . . .

I want to see the data and reasoning he used to conclude 616 is correct, even though it's in the minority of manuscripts. . . .

Irenaeus in the second century, a century before the manuscript Parker relies on, already knew of the 616 variation and discounted it as an error. . . .

. . . Irenaeus was proposing (even in the second century - a century BEFORE this oldest surviving copy!) that old, Greek copies of Revelation contained an error of copying in which the Greek letter xi with gematraic value 60 was wrongly copied into the Greek letter iota with number value 10.

Normally, I wouldn’t look to MTV (http://www.mtv.com/news/articles/1501490/20050509/index.jhtml?headlines=true ) on a subject such as this, but at least the author had the sense to cite interviews with a few more people (unlike the original writer of the article spreading around right now):
"It is clearly an important new manuscript, giving us a relatively very early copy of the text of Revelation," said Christopher Tuckett, a theology professor at Oxford University's Pembroke College. "It is probably not the earliest manuscript of Revelation that we have ... but this is the first time [the 616 reading] has been found in such an early text. . . ."
[Note: Oxford University is the place doing the imaging of the manuscripts. The fragment appears to be significant in that it seems to be the earliest text in which 616 has been found, not because it proves that 666 is incorrect.]
The recent 616 discovery, which was found in a collection of documents recovered in Egypt, isn't exactly a whole new revelation. While it dates back the furthest, other ancient manuscripts of the Book of Revelation have the number as 616 instead of 666, provoking some debate in the past as to which were the original digits. . . .

Alan Mitchell, a theology professor at Georgetown University, said there's no reason the discovery should detract from the popularity of 666. "In my opinion, it doesn't change anything," he said. "The most reliable manuscripts have the number as 666. . . .”

This (http://ralphriver.blogspot.com/2005/04/number-of-beast-616.html) person has a few things to add:
My copy of Nestle-Aland (27th ed.) at Revelation 13:18 lists for the variant reading "616" only "C; Ir mss" (the 5th century uncial manuscript C and some manuscripts cited by Irenaeus). A 3rd or 4th century papyrus containing this reading would be extremely significant, although probably not enough to outweigh the many witnesses for "666 . . . ."

For laypeople, I want to emphasize these points: (1) the most likely reading of the number in Revelation 13:18 is still "666"; (2) the reading "616" has in fact been known for many years, and even the new papyrus has been known since the 1990's; (3) the variation between "666" and "616" does not materially affect the interpretation of the book of Revelation. In short, the reading "616" is mainly interesting to textual critics of the New Testament and is unlikely to make a change in anyone's Bible or beliefs.

This (http://www.religionnewsblog.com/11139/Daniel-B--Wallace-responds-to-article-on---the-number-of-the-Beast) person appears qualified to comment:
Actually, the verdict is not in on this one yet. I am inclined to the view that the original wording here was 616, but a lot of work is needed to determine this. Although this is the earliest fragment for this portion of Revelation, the fragment's textual affinities and general reliability still need to be examined fully.

Further, the number 616 was known in antiquity and was discarded in the second century. Irenaeus, the patristsic commentator, wrote a chapter on the number of the beast, arguing that in the better manuscripts of Revelation that he had seen the number was 666 instead of 616.

To be sure, his perspective was theologically motivated (he gave the interpretation of 666 as striving for perfection [represented by the number 7] but never able to achieve it). But the fact that he was writing in the second century tells us that BOTH numbers existed at that time.

It may well have been Irenaeus' input that caused scribes to alter the text to 666 if 616 was in the exemplar that they used. But the point here is that one cannot simply appeal to the earliest manuscript and assume that the case is settled. Textual criticism is not done in such a simplistic manner. Date is indeed important, but there are several other factors involved.

We are currently conducting several tests to determine whether 616 is indeed the number of the beast. If so, it will certainly have interesting (though fairly benign) implications. But this is neither as sensational nor as certain as the article made it out to be. I would urge a bit more caution in representing this discipline.

aaaaaand if that were the case then why would John say it is a "human" number he is letting the reader know that there is a significance to the number and that a real person was behind it.
Not necessarily. From here (http://www.catholicintl.com/noncatholicissues/666.htm):
Although many people throughout history, especially in recent times, have sought to attach a specific person to the number 666 in Apocalypse 13:18, these are at best unproven speculations. . . .

One of the reasons for the rise of such speculative interpretations of 666 is that most translations of Apocalypse 13:18 read: “the number is that of a man and his number is 666.” The actual Greek is “arithmos gar anthropou estin.” Depending on the meaning of the noun “anthropou,” it should be literally translated as “for it is number of mankind” or “for it is a human number,” and with the remote possibility of “it is the number of a man.”

The word “anthropos” is the usual word in Greek to speak of “mankind” or a man in the general sense of the word (e.g., Mark 1:17; 2:10; Apoc 4:7; 9:5), although in rare instances it is sometimes used for an individual man (Mark 14:71). Of the 25 instances of “anthropos” in the Apocalypse, all are general references to mankind or man in general. The Greek word “aner” is the usual word for an individual man or individual men (e.g., Mark 6:20, 44). The Apocalypse does not use “aner” except for Apoc 21:2.

There is quite a bit more on this on the site, but the author concludes:
Lastly, Parker’s attempt at making Caligula a candidate for the number 616 is also not as precise as he assumes it to be. It could only refer to Caligula’s if his name is rendered “Cajus Caesar” (Greek: “Gaios Kaisar”), and this is probably the reason why a scribe of the third or fourth century made a variant text containing 616. It was a tempting interpretation, since Caligula erected an image of himself in the temple at Jerusalem, and he reigned from March 37 AD to January 41 AD, which is 3 years and 10 months (or approximately three and a half years, which would seem to equate with a literal rendering of the 3.5 years of Daniel 9:24-27 and Apocalypse 12:14).
all the best!
emily

stoph
August 1st, 2005, 03:38 AM
woah this is becoming the thread of massive posts! my brain hurts..

emily g
August 1st, 2005, 03:55 AM
My speel on macroevolution was an overview, not a definition (which was stated clearly). I chose to highlight the fact that macroevolution is disputed within the secular scientific community and not just some exclusive little notion held by Creationists.
Hmmm . . . I think you failed on this point, then. What you posted says that people in the secular scientific community dispute the PROCESS by which macroevolution occurs, not that they dispute macroevolution itself.

heyyy.. anyone notice that im debating with no less than four others at one time? i am a mere mortal, this shouldnt be happening
Heh, I certainly don't envy you.

emily

Mr. Visions
August 1st, 2005, 07:29 AM
What I find funny is that back in the day, when scientist and some misguided, "those who didn't fully study their bible" church leaders thought the Earth was flat. What's funny about it is the Bible always said the Earth was round...

"It is he that sitteth upon the circle of the earth, and the inhabitants thereof are as grasshoppers; that stretcheth out the heavens as a curtain, and spreadeth them out as a tent to dwell in:" - Isaiah 40:22

Could Science at the time made a mistake? Could the Bible be right? Gasp! We all know that Humans are perfect, so their theories have to be as well.

- Visions

MoP
August 1st, 2005, 07:50 AM
Mr. Visions: What are you trying to prove here? That some ancient and easily-variable statement shows conclusively that the authors of the Bible knew the Earth was a sphere before anyone else did, and recorded it in this manner? That's really getting a liiittle far out there.
I bet you could tag any number of meanings to "sitteth upon the circle of the earth" to suit a wide variety of points or arguments you wanted to make based on the "truth" found in scripture.

The science of the time had not discovered enough about the world or the solar system to prove conclusively any of their theories.

I would also like to point out that even though many learned men may have originally thought the earth was flat, there were later theories based on observations and calculations, that it was not - it can now be proved conclusively that these theories (although they were probably scoffed at when first suggested) are correct.

Is it so difficult for you to believe that the current theories that scientists hold (re: evolution) might not be proven irrevocably true in the near future?

Oregano: Hehe, I liked the "Dragon in the garage" analogy, hadn't heard that one before...

Emily G: I really enjoy reading your posts, very informative , well-worded and solid arguments that appear to be pure, sensible logic and science.
Am I right in thinking you were one of the people who was sitting with us at the Chinese restaurant with the big round table on the night before the start of the San Francisco workshop?
Shame I didn't get a chance to properly talk to you, you sound like a very intelligent and interesting person.

Side note to the Creationists who may be reading - my mother is a practising Christian, and a very good, sensible and generous woman (also a medical doctor). She has no illusions about the Christian creation myth, this does not stop her from being a very good and religious woman.
Why is it so hard for so many Christians to understand that it's possible to be a good person in the eyes of their Lord without having to spout evident nonsense about how a large planetary mass was created by an all-powerful invisible being in just shy of a week?

dfacto
August 1st, 2005, 08:58 AM
Yes, to an extent, evolution (in specific faucets) is perfectly agreeable, as it is observable and consistent (in those specific areas). What I do not subscribe to, and what is the basis for the neo-Darwinian theory is, and I’ll quote Dr Lee Spetner on this one – "[that] all life descended with modification from a putative single primitive source."

Good, now you've defined your specific gripe with evolution, and we can discuss it without being sidetracked by things that we both accept as true.

So from now on, lets argue about this "[that] all life descended with modification from a putative single primitive source." and the larger macroevolutionary steps only.

We both admit that micro and macroevolution are quite possible when smaller steps, such as order to species, are taken into account, so lets just stop arguing about that. We've wasted enough time bickering about that.

Also, lets not argue about the Old Earth/New Earth theories. If we are to argue about prokaryotes and their evolution into higher life forms, then we must accept that 3 billion (or somewhere thereabouts) is the correct timespan. Since the theory only works with that timespan and the Old Earth theory, that is what we should stick to.

Mutations are the crux of the NDT, and the occurrence and effect of these mutations are random. Mutations, as has been discussed previously, alter the genome of the organism, either doubling or cutting-and-pasting, or emitting certain genetic details altogether. They can lead to a beneficial change (given the organism’s circumstance) or (as is observed more frequently), an undesirable change.

As I said, even a small fraction of good mutations in the span of 3 billion years would lead to a gigantic amount of beneficial genetic mutation.

You have yet to make a good rebutal to this, and you really can't, seeing as it is a matter of rudimentary statistics. Even if mutations were not capable of causing drastic changes to an organisms DNA structure, but could only make minor changes, as you suggest, then the amount of beneficial minor changes would still be extremely large within the timespan previously mentioned. Do you agree, so that we can leave this particular stumbling block behind?

Also, here is a good link to biological information about genetic mutation. The bar on the side contains the articles on the page.

http://www.biology-online.org/2/1_meiosis.htm

And here are the most importtant ones, relating to chromosomal mutations.

1)http://www.biology-online.org/2/7_mutations.htm
2)http://www.biology-online.org/2/8_mutations.htm
3)http://www.biology-online.org/2/9_mutations.htm

Some interesting quotes:

from #1Deletion of a Gene

As the name implies, genes of a chromosome are permanently lost as they become unattached to the centromere and are lost forever
...
New chromosome lacks certain genes which may prove fatal depending on how important these genes are
Duplication of Genes

In this mutation, the mutants genes are displayed twice on the same chromosome due to duplication of these genes. This can prove to be an advantageous mutation as no genetic information is lost or altered and new genes are gained
...
New chromosome possesses all its initial genes plus a duplicated one, which is usually harmless


from #2Inversion of Genes
...
The new sequence may not be viable to produce an organism, depending on which genes are reversed. Advantageous characteristics from this mutation are also possible

Translocation of Genes

This is where information from one of two homologous chromosomes breaks and binds to the other. Usually this sort of mutation is lethal
All of the genetic mutations looked at through the last 2 pages more or less have a negative impact and are undesired, however, in some cases they can prove advantageous.


Page #3Polyploidy is responsible for the creation of thousands of species in today's planet, and will continue to do so. It is also responsible for increasing genetic diversity and producing species showing an increase in size, vigour and an increased resistance to disease.

Barring all external factors, mutations occur very rarely, and are rarely expressed because many forms of mutation are expressed by a recessive allele. IE: An organism left to itself will generally not mutate, and most mutations will be harmless, as your quote from yesterday stated.
However there are many mutagenic agents that artificially increase the rate of mutations in an organism. The following are some factors that increase genetic mutations in organisms

* Members of species in a particular geographic area or ethnic origin are more susceptible to mutations
* High dosages of X-Rays or ultraviolet light can increase the likeliness of a mutation
* Radioactive substances increase the rate of mutations exponentially


One can assume that the young earth, as a chemical soup, would have had an extreme amount of mutagenic agents available to mutate any lifeform present, not to speak of the sun itself. This means that not only are we lookng at 3 billions years of mutation, but at 3 billions years that would have had a greater rate of mutation earlier on, further increasing the amount of possible beneficial mutations.

Also, from the link it is finally put to rest (with a credible source) that both good and bad mutations are possible, with harmful mutations being more common. However, this doesn't change anything, since we've been assuming it was that way anyways.

For all life to come from a single source, there must have been many multiple series of beneficial mutations within that particular genetic strain. Each subsequent mutation must have built on the previous mutation to allow a shift from the norm. This implies that through mutation there is an increase in overall complexity of DNA. This falls back to my notation (prompted by emily g) that the doubling of a genetic detail will not constitute for an increase in complexity, as it was always within the organism’s capacity to have that trait doubled in the first place.

Stop thinking one mutation at a time, because it doesn't work that way.

What happens when you have a diploid organism that has a polyploid "offspring" (it can be a plant seed, or something simple like a cell splitting), as noted in link #3? The offspring has more chromosomes, although they are doubled up. Will this have an effect, no effect, who knows. Without analyzing the DNA, or simply observing the organism it may be very hard to tell, but the fact is that it has more genetic material than it's parent and is therefore more complex. This genetic material, when passed on and further mutated in subsequent generations, would then undergo other types of genetic mutations. Now tell me if you agree with this example, and the statement that follows it

There are two DNA strands, with the one side of the helix segment reading: GTAAACGGTCAGTAG. This strand becomes doubled in the offspring of the original bearer, and is now GTAAACGGTCAGTATGTAAACGGTCAGTAT. This is then further mutated, and the offspring's offspring then bears this: GTAAACGGTCAGTATGTAAACGGTCAGTAG instead of GTAAACGGTCAGTATGTAAACGGTCAGTAT.* This sequence is now not only more complex than the original, but is also more than a simple doubling of information.

*As you may or may not know, DNA, in it's m-RNA form, is repsonsible for protein synthesis, as it provides the necessary codons to create amino acids, which are hooked together to form proteins. A codon is composed of three consecutive bases, ie: GUA, AUC, etc. In RNA, T (Thymin) is replaced with U (Urasil). There are 64 different codon combos that you can have, and they are responsible for telling the ribosomes which amino acids to produce. Here is the codon chart that should explain the process abit. If you want more information, the do an internet search for codon, ro something like that. Should bring up lots of information. http://iusd.k12.ca.us/uhs/cs2/images/Codon_Chart.gif

The STOP codon combinations are what tell the ribosomes to stop synthesis. TAG (or UAG in RNA) is a stop codon. If you double your code, and change the end to a stop codon instead of a Tyrosin codon, then you have just complexified your genetic code, by adding a new and unique segment. It will no longer continue to synthesize amin o acids, but will stop at that point. Along with the extra information that was added by the doubling, you may now have a segment that produces a completely new protein which that organism was unable to produce before due to a lack of genetic complexity. But is it good, it is bad, is it harmless? Who knows, it could be any of those, but either way, the genetic code has become more complex, which blows your theory out of the water. Complexity through mutation is possible.



Complexity is key, here, and I know I sound like a broken record, but I’ll push this as far as I feel is necessary. When a mutation occurs in an organism, it either reduces, or mirrors the current level of complexity in the genetic structure.

Partially true. It can reduce it, it can mirror it, OR it can simply alter. You don't believe that a simple mirroring itself is an increase in complexity, but that isn't necessary for me to prove that complexity is possible. Mirror a segment, and reduce the mirrored segment's information by taking out a portion. You now have an altered mirrored segment which is different from the original. A new segment is born and the complexity increases. Mirror a segment and flip some part inside of the mirrored segment. You now have a new segment altogether, and an increase in complexity.

A single mutation will not be able to increase the structural complexity of DNA by itself, but multiple mutations would. Since we are talking about a process that has a very long time to take place, that complexification is in no way impossible.

Is it a logical progression for a human being to have descended (not directly, of course) from a less complex organism such as a single-celled amoeba?

Of course. If there is, say 2 billion years worth of separation between them, then there are countless mutations between them that can increase the complexity in the afformentioned way.

“The chain [of mutations] must be continuous in that at each stage a change of a single base pair somewhere in the genome can lead to a more adaptive organism in some environmental context. The concept of the adaptive landscape is useful here. This concept was first introduced by Sewall Wright, but now nucleotide sequences of the mean population genome have taken the place of Wright’s gene combinations. There are a great many adaptive hills of various heights spread over the genomic landscape. NDT then says that it should be possible to continue to climb an “adaptive” hill to a large global maximum (or near-maximum), one base change at a time, without getting hung up on a small local maximum. No one has ever shown this to be possible.”

Well no shit. We've known what DNA is for less than 50 years. How the hell does anyone with half a brain expect us to be able to spot or otherwise analyze DNA changes on an evolutionary scale? This is nothing more than stating the obvious, which is that it is all theory. It proves as much as me saying that nobody has proven the existance of the Ark. Please do not bring these sorts of quotes into this thread, because they aren't good for anything. Lets keep it to arguments.

“the Earth’s early atmosphere before 3.5 Ga could have significant quantities of oxygen. This should discourage the sort of hypothesising on abiotic monomer and polymer syntheses so often assumed to have occurred in Archaean times.”

No website link? No source listed? No actual information on why he thinks so? What's that supposed to prove? In addition to that, Dr. Aw Swee-Eng is obviously a very Godstruck person, which makes his words rather suspect in relation to evolution. In this interview http://www.answersingenesis.org/creation/v16/i2/soup.asp he talks about God right before going into abiogenesis. Ehem...

He also drop stuff like: the more difficult it is to imagine that such an intricate thing could have just evolved by sheer random process over time without any directive force.

and idiot statements like this which can be destroyed with a single word: MICROSPHERES!

What about the belief that, ‘OK, today’s cells are very complex, but maybe the first one didn’t have to be that complex,’ is that a logical position?

This concept of the ‘protocell,’ it’s sheer nonsense because a cell by definition must have enormous metabolic complexity or it will not survive. It’s not just a bag of protoplasm with just fluid and a few salts and bits of furniture floating around, but it’s built to control itself and propagate itself and for that there must be a minimum complexity which is the problem for ‘chemical evolution.’

http://www.answers.com/topic/microspheres

In 1953, Stanley Miller and Harold Urey demonstrated that many simple biomolecules could be formed spontaneously from inorganic precursor compounds under laboratory conditions designed to mimic those found on Earth before the evolution of life. Of particular interest was the substantial yield of amino acids obtained, since amino acids are the building blocks for proteins.

In 1957, Sidney Fox demonstrated that amino acids could be encouraged to polymerize upon exposure to moderate heat. These polypeptides formed spherical shells—microspheres. Under appropriate conditions, microspheres will bud new spheres at their surfaces.

A microsphere is also described as a protocell.

Further work revealed that these amino acids and small peptides could be encouraged to form close spherical membranes, called microspheres. Fox has gone so far as to describe these formations as protocells
http://www.answers.com/main/ntquery;jsessionid=21dkrnlnr83ec?method=4&dsid=2222&dekey=Sidney+W.+Fox&gwp=8&curtab=2222_1&sbid=lc02b&linktext=Sidney%20Fox

So since protocells have already been lab created, Dr Swee-Eng is full of hot air when he says that it is nonsense.

I find it rather ironic that people say it is impossible for life to form over the course of billions of years, when two guys got that close to it in a science lab, in an infintesimal fraction of the time.

S.C. Watson
August 1st, 2005, 09:52 AM
Yes, to an extent, evolution (in specific faucets) is perfectly agreeable, as it is observable and consistent (in those specific areas). What I do not subscribe to, and what is the basis for the neo-Darwinian theory is, and I’ll quote Dr Lee Spetner on this one – "[that] all life descended with modification from a putative single primitive source."

I think dfacto more than adequetly answered your objections.

However, I would like to pose an objection of my own: Please stop relaying on Creationists posing as scienctists as reliable sources. Again, these people have an agenda that they are pushing and therefore their "science" is suspect and does your argument little good, and frankly will be easily refuted and dismissed by myself or someone else every time.

In short, please do not rely on psuedo science to support your argument. Psuedoscience is self serving to the individual who propogates it and will leave you hanging every time you really need the support.

Dr. Lee Spetner is a creationist in scientists' clothing (http://www.trueorigin.org/spetner2.asp)

WindWalker
August 1st, 2005, 10:30 AM
Ugh, so many things I want to reply to, so little time to do it! Stoph, Emily, you guys rock. :)

Side note to the Creationists who may be reading - my mother is a practising Christian, and a very good, sensible and generous woman (also a medical doctor). She has no illusions about the Christian creation myth, this does not stop her from being a very good and religious woman.
Why is it so hard for so many Christians to understand that it's possible to be a good person in the eyes of their Lord without having to spout evident nonsense about how a large planetary mass was created by an all-powerful invisible being in just shy of a week?
When did anyone here say it was impossible to be a devout follower of Christ and believe Neo-Darwinist theories? Lest I remind you, I was the same as your mother. Rather, it is the principal behind the matter. What it comes down to is this one question: is the Bible true or not? After all, if part of it isn't true, how do we know other parts are true? Neo-Darwinist theories do not correspond with the Biblical account of Creation in Genesis. When you try to combine the two, guess which one gets edited.


Hehe, On thing that gets me is how science (and people in general) has gotten such a big head. We all act like, through our own advancement in technology, we now know everything there is to know...peroid. Oh, no one would admit it, of course, but somewhere in the back of most people's minds, they know EVERYTHING. There is no God. Man created himself through random mutation. Most of the evolutionist scientists I've known have been bigger bigots than most of the overzealous, right-wing Christians I know.

:^^;: Eh, got on a bit of a rant there. It's just frustrating how so many people think they know it all, even me at times. Guess we're all only human.

Mr. Visions
August 1st, 2005, 10:32 AM
[QUOTE=MoP]Mr. Visions: What are you trying to prove here? That some ancient and easily-variable statement shows conclusively that the authors of the Bible knew the Earth was a sphere before anyone else did, and recorded it in this manner? That's really getting a liiittle far out there.
I bet you could tag any number of meanings to "sitteth upon the circle of the earth" to suit a wide variety of points or arguments you wanted to make based on the "truth" found in scripture.

The science of the time had not discovered enough about the world or the solar system to prove conclusively any of their theories.
I would also like to point out that even though many learned men may have originally thought the earth was flat, there were later theories based on observations and calculations, that it was not - it can now be proved conclusively that these theories (although they were probably scoffed at when first suggested) are correct.

Is it so difficult for you to believe that the current theories that scientists hold (re: evolution) might not be proven irrevocably true in the near future?]

Exactly what I'm trying to say. Scientist in many ways are playing catch up. Does the Bible tell us all the secrets to the universe and will tell us all we need to know about Science? No! God what us to discover knew things and learn about our vast envirement we call the universe, but He also wants us to give him some credit. What I'm saying in the end is God is God, and we are not. We're all human, including scientists, and therefore science is open to error.

Please, don't get upset, I'm just just sharing. Collect yourself, then type. I'm willing to listen.

- Visions

dfacto
August 1st, 2005, 10:32 AM
Haha, good link Oregano. That guy is definitely not quote worthy. Well, maybe for ridicule.

That primitive source of life is assumed to be sufficiently simple that it could have arisen from nonliving material by chance. There is no theory today that can account for such an event, but I shall not address that issue here.

Microspheres! There's that pesky word again.

Moreover, as I have noted in my book, the large mutations such as recombinations and transpositions are mediated by special enzymes and are executed with precision - not the sort of doings one would expect of events that were supposed to be the products of chance.

They are precise because without mutations, that is exactly how the process is supposed to run. A sloppy sequence duplication is no good for meiosis. The fact that this precision is still apparent during a bad duplication is no big surprise.

Precision does not in any way mean that the effect will be desired. A precise surgical incision in the wrong place can kill a patient. A precise duplication gone wrong can change a genome.

But our inability to observe such series cannot be used as a justification for the assumption that the series Darwinian theory requires indeed exist.

Quite so, but that's an ironic thing to say when you are just throwing that fact in their faces as an apparent disproof.

He then goes on to say that the burden on proof is on proponents of NDT.

I don’t have to assume the series did not occur to make a case for the inadequacy of NDT. You, who are basing your theory of evolution on the occurrence of such a series, are required to show that it exists, or at least that it is likely to exist. You are obliged to show an existence. I am not obliged to prove a non-existence.

Which is true, and not true. The proponents must prove their theory as best as they can, which is what they have been doing, and will continue to do. Creationists must also prove them wrong. Creationism cannot prove itself right, since it relies on the existence of an unprovable god. When you cannot prove that your theory is right, you must prove the other theories wrong.

And it goes on from there, but whatever. The man is not credible, and this link is a good example, as he gets his ass handed to him on a plate, whereapon, he breaks correspondence (very bottom):

I suggest that you read this stoph, it is very informative.
http://home.wxs.nl/~gkorthof/pdf/korthof36b.pdf

dfacto
August 1st, 2005, 10:36 AM
"sitteth upon the circle of the earth"

Proves nothing. A circle is two dimensional.

Now, if it said "sitteth upon the sphere", that would be something! :P

NoSeRider
August 1st, 2005, 10:44 AM
Oh for pete sake......you evolved from pond scum. Can't we just leave it at that and call it a day?

wassermelone
August 1st, 2005, 10:55 AM
When did anyone here say it was impossible to be a devout follower of Christ and believe Neo-Darwinist theories? Lest I remind you, I was the same as your mother. Rather, it is the principal behind the matter. What it comes down to is this one question: is the Bible true or not? After all, if part of it isn't true, how do we know other parts are true? Neo-Darwinist theories do not correspond with the Biblical account of Creation in Genesis. When you try to combine the two, guess which one gets edited.

Aesop's Fables are rather obviously untrue, but thats not really the point. I would say its the same way with the bible. Not factual... but really a guide book for morality. At least this is the fashion in which many people who believe in god and not creationism say it.

WindWalker
August 1st, 2005, 11:08 AM
Please stop relaying on Creationists posing as scienctists as reliable sources. Again, these people have an agenda that they are pushing and therefore their "science" is suspect and does your argument little good, and frankly will be easily refuted and dismissed by myself or someone else every time.
Out of curiosity, would a scientist who buys the whole evolution thing, researching, studying, and perhaps even teaching it for several years, then later, through his own study, discovers discrepancies in the theory and begins to study Creationist theories be a Creationist posing as a scientist?

That's another thing that really gets me steamed..."Creationism is a psuedoscience! Creationists have faith in God, so their theories should be dismissed (not questioned, dismissed)!"

A while ago, when I was an avid follower of Neo-Darwinism, I had quite a bit of faith as well. Not so much in God, but in the almighty Sciences of men. Cuz people are perfect. Honestly, it took a HECKOVA lot more faith than any religion.

All theories should be questioned scrupulously, but to dismiss it as mere fantasy on account of faith in something...Shouldn't most theories just be dismissed then? Most articles I ever read reguarding evolutionist ideas almost always say, "naturally, it is assumed that..." or something of the like. It's always conjecture based on assumption based on a teensy scrap of evidence deemed conclusive by a board of scientists with presuppositions on how things are supposed to work. They have faith in themselves...in men. I think they should be equally questioned just as those who have faith in a higher power.

dfacto
August 1st, 2005, 11:21 AM
All theories should be questioned scrupulously, but to dismiss it as mere fantasy on account of faith in something...Shouldn't most theories just be dismissed then? Most articles I ever read reguarding evolutionist ideas almost always say, "naturally, it is assumed that..." or something of the like. It's always conjecture based on assumption based on a teensy scrap of evidence deemed conclusive by a board of scientists with presuppositions on how things are supposed to work. They have faith in themselves...in men. I think they should be equally questioned just as those who have faith in a higher power.

There's a reason that people don't question science as much as religion, and that is because it requires far less faith, and it works. Science seeks to expose the facts, and does so in many situations with conclusive proof. Where facts are not directly provable, theories are erected that function very well at explaining whatever it is they should. Religion proves nothing, and, objectively viewed, is a form of dementia*.

So do you trust those that are trustworthy, or the crazy people who tell you to blindly believe?**

*Magical stories of all powerful beings without a single shred of conclusive proof? Yeah, sounds like dementia to me.

**Some would say that science requires the same blind belief, which is untrue. Science is built upon strong foundations of knowledge, that anyone can acquire. This knowledge is testable, provable, and therefore requires no faith. If people believe it blindly, then that is their own problem, as they have not taken the time to become better acquainted with the material.

wassermelone
August 1st, 2005, 11:28 AM
Out of curiosity, would a scientist who buys the whole evolution thing, researching, studying, and perhaps even teaching it for several years, then later, through his own study, discovers discrepancies in the theory and begins to study Creationist theories be a Creationist posing as a scientist?

That's another thing that really gets me steamed..."Creationism is a psuedoscience! Creationists have faith in God, so their theories should be dismissed (not questioned, dismissed)!"

It could so happen that a scientist could disprove evolution with enough scientific evidence. However, it hasn't happened yet.

Creationism really IS pseudoscience.
Science = Examining data causes you to reach a conclusion.
Creationism = A conclusion that causes you to only accept data that fits the presupposed conclusion.

Even IF a creationist were to somehow deliver the final coup de grace to evolution, it wouldn't be science until someone who does not already ascribe to creationism follows the data and concludes that evolution cannot possibly be under that data.

WindWalker
August 1st, 2005, 11:33 AM
Proves nothing. A circle is two dimensional.

Now, if it said "sitteth upon the sphere", that would be something! :P

Truely, it cannot be proven either way. The Hebrew word used is chuwg (khoog), meaning "a circle, circuit, or compass". This could be seen in many ways. We don't really know for sure how ancient Hebrews would have taken it.

I found this to be an interesting read on the subject: http://www.tektonics.org/af/earthshape.html

light
August 1st, 2005, 11:43 AM
Okay, this is getting slightly out of hand. A thread started about a spaghetti god and its noodly appendige, and it turns into a serious discussion? How the hell did that happen? Whats next, the out of context thread turns into a discussion of whether the worlds flat?

WindWalker
August 1st, 2005, 11:56 AM
Science = Examining data causes you to reach a conclusion.
Creationism = A conclusion that causes you to only accept data that fits the presupposed conclusion.

Even IF a creationist were to somehow deliver the final coup de grace to evolution, it wouldn't be science until someone who does not already ascribe to creationism follows the data and concludes that evolution cannot possibly be under that data.
Actually, this would be more accurate:

Science = Examining data that causes you to reach a conclusion based on presuppositions.
Creationism = Examining data that causes you to reach a conclusion based on presuppositions.

They BOTH deal with presuppositions, really. One supposes everything evolved from a single ancestor. The other supposes all was created by a higher power. "Proven" evolutionary evidence often doesn't mean a lick to me, because I base my conclusions on my presuppositions. Creationist evidence doesn't mean a lick to you because you base your conclusions on your own presuppositions.

Secondly, even if that did happen, or even the other way around...it wouldn't matter. From what you're saying, if Creation was proven, an evolutionist would have to verify it, but if evolution was proven, an Evolutionist would have to verify it. A little one-sided, dontcha think? That and a tad impossible. Were an Evolutionist to verify that Creationism is true, wouldn't that make him now a Creationist? And besides, why on earth would an evolutionist subscribe to Creationism when evolution suits them just fine?

Especially when it often means losing grant money....

Ssenkrah Semaj
August 1st, 2005, 11:58 AM
Okay, this is getting slightly out of hand. A thread started about a spaghetti god and its noodly appendige, and it turns into a serious discussion? How the hell did that happen? Whats next, the out of context thread turns into a discussion of whether the worlds flat?

That letter was a clear joke about the validity of teaching creationism in schools and the writer wrote it in hopes it would spark a debate....and would you look at that's what we are doing dude.

WindWalker
August 1st, 2005, 12:04 PM
That letter was a clear joke about the validity of teaching creationism in schools and the writer wrote it in hopes it would spark a debate....and would you look at that's what we are doing dude.
Just what I was thinking.

And debate (so long as it's civil) is good for you. It broadens your horizons and helps you learn about other's beliefs and question your own to see if they hold up.

S.C. Watson
August 1st, 2005, 12:06 PM
Okay, to coin a phrase: I *really should be working...*

Out of curiosity, would a scientist who buys the whole evolution thing, researching, studying, and perhaps even teaching it for several years, then later, through his own study, discovers discrepancies in the theory and begins to study Creationist theories be a Creationist posing as a scientist?

No. Provided that said scientist could provide proof of his findings. In which case, nothing would change (in that it would still be science).

The problem that I am having here is that we have people who are creationists first who take on the mantle of science to prove their beliefs. This is most definately the way science *dose not work*.

If they could provide some shred of evidence, instead of poorly cobbled together arguments formulated over fundamental misunderstandings of the process, and provide it for peer review and *accept the verdict* of the review, this would not be an issue.

That is the process of science.

That's another thing that really gets me steamed..."Creationism is a psuedoscience! Creationists have faith in God, so their theories should be dismissed (not questioned, dismissed)!"

No. Firstly, allow me to explain that yes, creationism is a psudo-science in the same way that astrology is a psudo-science. It is a belief system that turns facts to support itself and is not accountable to something that proves it wrong.

If creationism were to allow for checks and balances within its structure, we'd have something a little closer to science. However, it does not. As we have seen, it often manipulates and misconstrues facts to support itself. This is not science.

Science will more often than not break a hypothesis or theory to pieces based upon close scrutiny. This is the purpose of science. This is why creationism, and beliefs, fall apart when scrutinized.

A while ago, when I was an avid follower of Neo-Darwinism, I had quite a bit of faith as well. Not so much in God, but in the almighty Sciences of men. Cuz people are perfect. Honestly, it took a HECKOVA lot more faith than any religion.

I'm not sure I follow your point here - that you converted from science to religion? That's an interesting thought exercise - do you no longer hold with electricity, gravity, flight, combustion or medical science? or do you cherry pick what you accept and what you don't based on what is dictated by the pedagog? No offense, seriously. I'm curious.

All theories should be questioned scrupulously, but to dismiss it as mere fantasy on account of faith in something...

All theories are questioned scrupulously. However, the faith equation in all of this is really irrelevant to the facts of the argument. The problem, again, is that creationism and Intelligent Design's flaws are in that they attempt to make the facts fit the idealogy, and that doesn't work.

Shouldn't most theories just be dismissed then?

Most are, frankly. And rightly so.

Most articles I ever read reguarding evolutionist ideas almost always say, "naturally, it is assumed that..." or something of the like. It's always conjecture based on assumption based on a teensy scrap of evidence deemed conclusive by a board of scientists with presuppositions on how things are supposed to work. They have faith in themselves...in men. I think they should be equally questioned just as those who have faith in a higher power.

I have faith in humanity. (personally, I think women are just as likely to come up with something valid as a man, but that's just me :P )

To the point, though: I would have to see the articles that you are referring to. However, my guess would be that they presume a certain understanding of the topic at hand for the sake of discussion.

And as for them being questioned, certainly. That's what it's all about. However, when the proof that is asked for is provided, why is this not accepted?

I find that truly amazing, and frankly a little bewildering to boot. Creationists and Intelligent Design proponants say that evolution is not valid. It's called a myth, a pipe dream. Okay, fine. All the evidence you could ever want is provided, complete with people who are willing to take time out of their schedules to help anyone understand this process, but still allow for independed conclusions to be drawn, and yet, after all of this, when it has been *shown* time and again that evolution is something that is real, both micro and macro, and it is *still* denied with the "yes-but" argument.

Where as the creationists and Intelligent Design proponants are unable to do the same.

Show us the money. Give *us* proof. Show us unrefutable evidence that there is an intelligence behind all of this. Show us god without falling back on faith.

If this can be done, the argument will be settled, I promise. However, time and again, the people who claim that evolution is a sham have failed to do this, but have screamed all the louder that science is at fault. They have used trickery and lies and deciet to achieve their ends.

I lay my lot with humanity. Thanks.

wassermelone
August 1st, 2005, 12:10 PM
Actually, this would be more accurate:

Science = Examining data that causes you to reach a conclusion based on presuppositions.
Creationism = Examining data that causes you to reach a conclusion based on presuppositions.

They BOTH deal with presuppositions, really. One supposes everything evolved from a single ancestor. The other supposes all was created by a higher power. "Proven" evolutionary evidence often doesn't mean a lick to me, because I base my conclusions on my presuppositions. Creationist evidence doesn't mean a lick to you because you base your conclusions on your own presuppositions.

Well you are equating science with evolution which isn't necessarily right. Science could disprove evolution at some point.

I also disagree that an evolutionist would balk at switching to something else should evolution prove incorrect. Sure I think both are "beliefs" per se (many argue this), but not in the same grain/basis. Evolutionists (should) believe in evolution because science has much evidence in support of it while creationists believe in creation because the bible says so. The very core of science is that you follow the evidence rather than a presupposition. The very core of the bible is that it is the infallable word of god.

figure2
August 1st, 2005, 12:11 PM
That letter was a clear joke about the validity of teaching creationism in schools and the writer wrote it in hopes it would spark a debate....and would you look at that's what we are doing dude.Actually, my original intent was to to allow us all to heap lots of derisive laughter at the Kansas School Board for their absurdity. I am more than satisfied at the response in this respect.

dfacto
August 1st, 2005, 12:17 PM
Actually, this would be more accurate:

Science = Examining data that causes you to reach a conclusion based on presuppositions.
Creationism = Examining data that causes you to reach a conclusion based on presuppositions.

I don't think you understand science Windwalker.


sci·ence Audio pronunciation of "science" ( P ) Pronunciation Key (sns)
n.

1.
1. The observation, identification, description, experimental investigation, and theoretical explanation of phenomena.

Science is based around the facts, and not the scientist (although there are those who practice bad science as well. What can ya say, people aren't perfect.) It starts with a hypothesis, and ends in a conclusion.

Pseudoscience seeks to wrap science around a preset conclusion, and engineer a hypothesis to make it work out. This is why pseudoscience falls apart when compared to real science, because taking the hypothesis and testing it will yield a negative reult, and the conclusion will be proved worthless.

If you don't think science works like this, then you are pissing on everything our society has achieved with science. With one broad stroke you are damning all of our advances, which were built upon a solid scientific foundation.

If science worked like you think, then nothing would have been accomplished. But guess what, we have marvels of technology all around us, brought to you by the people you deride, and their "presumptuous theories". How can you possibly type what you did when you're doing so over the internet? Typing on a computer, supplied with electricity from a generator, with the signals being sent to a server, and shuffled around the world, all based on solid, reproduceable, factual scientific evidence reached with the use of the scientific method. You actually believe that scientists know the conclusion of their results before they conduct the experiments? Are you seriously trying to tell me that?

You can diss science, but it works. It has changed the world in 300, 200, hell even just the last 100 years, more than anything before it in any timespan, but you still think you can take potshots at it's overall credibility just because you don't like what it says about your creation stories? Whatever.


:frustrated:

That was a bit too much. Sorry, but I have no tolerance for a blatant disregard for reality.

EDIT: took out some insults. That was out of line, and if you read them before I got to it, then I'm sorry. I just really can't stand when people go after science with accusations that it is all bullshit.

wassermelone
August 1st, 2005, 12:17 PM
Actually, my original intent was to to allow us all to heap lots of derisive laughter at the Kansas School Board for their absurdity. I am more than satisfied at the response in this respect.

I think he was talking about the original intent of the writer of the Spaghetti God theory rather than your original intent.

S.C. Watson
August 1st, 2005, 12:22 PM
If science worked like you think, then nothing would have been accomplished. But guess what, we have marvels of technology all around us, brought to you by the people you deride, and their "presumptuous theories". How the fuck do you have the guts to tell me this bullshit when you're doing so over the internet? Typing on a computer, upplied with electricity from a generator, with the signals being sent to a server, and shuffled around the world, all based on solid, reproduceable, factual scientific evidence reached with the use of the scientific method. You actually believe that scientists know the conclusion of their results before they conduct the experiments? Are you seriously trying to tell me that?

You can diss science, but it works. It has changed the world in 300, 200, hell even just the last 100 years, more than anything before it in any timespan, but you still think you can take potshots at it's overall credibility just because you don't like what it says about your creation stories? Whatever.


:frustrated:

That was a bit too much. Sorry, but I have no tolerance for a blatant disregard for reality.

Easy man. Take a deep breath. It's okay. Really. Allow for a learning curve.

dfacto
August 1st, 2005, 12:35 PM
Easy man. Take a deep breath. It's okay. Really. Allow for a learning curve.

Hehe, posted before my edit went through .

Yeah, I know, I shouldn't get worked up about this, but I can't stand it when people use arguments like Windwalkers in the midst of a serious discussion. It's absolutely false, and eaily proven as such, but they use it anyways. Bleh.

Also, I should note in a preemptive reply to possible responses, that science is not all absolutely correct, and I do not suggest that it is. Overall, science is nearly infallible, as the general push is forward, and the facts remain, while the BS is left to the side. However, catch science in any intermediate stage on any theory and you will likely run into many errors. Evolution is currently one of those theories. The basics of evolution are undeniable, but the theory is so large, and attempts to capture so much, that there are bound to be errors within it. But science irons out errors, and they will eventually be removed from evolution, while the facts will remain.

And what if evolution is proven to be wrong by some other theory? Well, quite simply, the other theory will be tested, and if it is true then it will become the primary theory. Currently, evolution is the primary scientific theory because it ties everything together and bases it upon facts. Creationism, for example, does not tie everything together, does not base it's conclusions upon facts, and cannot even prove the points that are absolutely crucial to it's argument. Therefore, it takes a backseat to evolution.


Also, in relation to the argument that me and stoph are having about the early formation of life, I would like to just point out that the origin of ife is not actually a proof or disproof of evolution, as evolution can only take place once a lifeform is present, meaning that it has nothing ot do with that lifeform's initial formation.

And Windwalker, I would like to apologize again. My argument stands, but the way I expressed it was out of line.

emily g
August 1st, 2005, 12:59 PM
When science is shown to be mistaken, it will revise itself. This has already demonstrated itself to be true many times in the theory of evolution since it was first proposed.

Creationism/I.D. will never admit or revise if it is shown to be mistaken--it will dodge and make excuses.

This problem wouldn't exist if Creationists/I.D.ists hadn't tied themselves to the literalness of the Bible. The Bible is FULL of symbolism--why not here as well? I don't understand this inconsistency.

emily

WindWalker
August 1st, 2005, 01:13 PM
I'm not sure I follow your point here - that you converted from science to religion? That's an interesting thought exercise - do you no longer hold with electricity, gravity, flight, combustion or medical science? or do you cherry pick what you accept and what you don't based on what is dictated by the pedagog? No offense, seriously. I'm curious.
Not converted from science to faith, no. Let me elaborate. Lol, who's ready for story time?

Not long ago, I believed that God used evolution to create the world, a theory known as Progressive Creationism/Theistic Evolution. It easily coincided with Neo-Darwinist theories of the time, and even today, because it allows for evolution, but still allows for Gods existence. Heck, it might even work with the Bible if you take the 6 days of Creation, not as literal days, but as huge spans of time! I was absolutly facinated with the whole process of evolution...dinosaurs into birds, apes into humans, etc. I started researching evolutionary theories, exciting new discoveries, that kind of thing. I found it left me with more questions than answers, including questioning the Bible as truth.

So then I found this "new" theory...the Gap theory. It explained the fossil record and allowed for God, and even a 100% true Bible! *ooh's and ahh's* So I went with that for a year or so, but again, found more questions than answers. The Bible states that when Adam sinned, death came into the world, but the Gap theory, just as Progressive Creationism, would have to allow for billions of years of death and destruction long before. And as I said before, if part of it isn't true, how do we know the rest is?

So I took Genesis literally, and things started making a whole lot more sense. No one can say it's completely 100% impossible for a higher power to have created everything from nothing. If anything, that explains theories of antimatter far better than random chance. The billions of fossils found in sedimentary (even igneous) rock make far more sense, with the account of a global flood. Even the idea of a young Earth: look at the decay and rapid reversal of Earth's magnetic field, the amount of helium in the atmosphere, the amount of salt in the oceans, and the wind-up of spiral galaxys.

Anyways, that's the basic gist of it. Although there was quite a bit more too it, I'm really not in the mood to write an autobiography. I'm sure this is now going to spark even more people to say, "where's the proof?!" Heck, I really don't care at this point. Whether I'm right, or whether I'm wrong, I believe the Bible to be the inspired Word of God. If I evolved, what am I gonna do? Cease to exist. w00t. :P

Of course, if some other religion turns out to be right, well...then I guess I'm screwed. ;)

wassermelone
August 1st, 2005, 01:13 PM
When science is shown to be mistaken, it will revise itself. This has already demonstrated itself to be true many times in the theory of evolution since it was first proposed.

Creationism/I.D. will never admit or revise if it is shown to be mistaken--it will dodge and make excuses.

This problem wouldn't exist if Creationists/I.D.ists hadn't tied themselves to the literalness of the Bible. The Bible is FULL of symbolism--why not here as well? I don't understand this inconsistency.

emily

A good example of this would be the Static State vs. Big Bang theories. The Static State theory was the popular scientific theory while Big Bang was originally put forth by a Jesuit priest as a possible conclusion for the evidence that the spiral nebulae was receding from the earth. As more evidence was brought forth and the case for the Big Bang strengthened... it eventually gained much more favor that the Static State theory. Now static state is virtually unheard of.

WindWalker
August 1st, 2005, 01:30 PM
And Windwalker, I would like to apologize again. My argument stands, but the way I expressed it was out of line.
Ah, even the best of people often let the worst of themselves out, even me. I went on a slight rant a few posts ago. No offense taken. After all, you can't please everyone. There will always be people in the world who will get pissed off at me for various reasons. That's just life.

When I said "Science", I should have written "Historical Science", as in the science of origins. I was not speaking of operational science, though many areas in that often deal with evolutionary ideas as well.

Operational science has given us such wonderful things as electricity, modern medicine, computers, etc. All of these achievements involve doing experiments in the present, infering from these results, and doing more experiments to test those ideas. The resulting conclusions are closely related to the experiments, and there is very little room for speculation. Historical, or origins science has to do with working out what happened in the past, and science is then limited because we cannot do experiments directly on past events and history cannot be repeated. We observe something in the present and draw conclusions about the past. These experiments are often quite limited, so they require a lot of guesswork. The farther in the past we try to study, the longer the chain of conclusions involved, the more the guesswork. This means the more room for non-scientific factors to influence the conclusions...factors like the religious belief or unbelief of the scientist. The resulting "science" reguarding the past may in fact be little more than the scientists personal world view.

The conflicts between science and religion occur regularly in historical science, but never in operational science. It is unfortunate that the respect earned by the success of operational science causes many to think that the conjectural claims arising from historical science carry the same authority.

Other than that, I'm pretty much done arguing the point. It's completely meaningless, not to mention a huge waste of time in the first place, because I'm sure no one is going to budge.

She has a problem with him, he has a problem with her. Lets all just get over it.

EDIT: I'm adding this reply in here so not to post so much. :D

The Bible is FULL of symbolism--why not here as well? I don't understand this inconsistency.
Why do so many people believe a literal interpretation of Genesis? Well, again it has to do with the context and the original Hebrew text. When the word, yom (day) is used with a number AND morning and evening, it always means a literal, 24 hour day. So either Genesis 1 is true, or it isn't.

S.C. Watson
August 1st, 2005, 01:33 PM
Heck, I really don't care at this point. Whether I'm right, or whether I'm wrong, I believe the Bible to be the inspired Word of God. If I evolved, what am I gonna do? Cease to exist. w00t. :P

I rest my case. There is no evidence for Creationism or Intelligent Design. Whether you believe or not is purely irrelevant.

Thanks for the discussion.

Daunting
August 1st, 2005, 01:51 PM
To me it always seems like more of a immature stubborness rather than true knowledge that keeps people in the religious ranks.

dfacto
August 1st, 2005, 01:55 PM
So then I found this "new" theory...the Gap theory. It explained the fossil record and allowed for God, and even a 100% true Bible! *ooh's and ahh's* So I went with that for a year or so, but again, found more questions than answers. The Bible states that when Adam sinned, death came into the world, but the Gap theory, just as Progressive Creationism, would have to allow for billions of years of death and destruction long before.

Well, it seems to me that you just went for it with the conclusion in mind. You want to believe in God, and evolution, so you went for whatever tied the two together. Did you stop and examine all options, such as evolution without a God? Did you try to fully understand the theory behind everything you researched?

I stick to evolution, without the concept of a God, because it makes perfect sense to me. I know a fair amount about evolution, evolutionary theory, and biology in particular, and I can honestly say that evolution does an excellent job of coherently tying together everything that I know without logical gaps.

Creationism is lacking to me because it rests entirely upon something which is not proven; a big departure from evolution. While it does very well explain everything (hell, God could do anything, so there's no problem), it does not support itself. Without a proof of God, there is no proof of creationism, and that is final. Without that solid base, I cannot accept anything else that creationism says.


And as I said before, if part of it isn't true, how do we know the rest is?

Because some of it is based upon observable, duplicatable, factual evidence which cannot be denied in any way shape or form? If some of it is true, then how do we know that the rest is false? See how those sorts of arguments can bite you in the ass?

I'm sure this is now going to spark even more people to say, "where's the proof?!" Heck, I really don't care at this point. Whether I'm right, or whether I'm wrong, I believe the Bible to be the inspired Word of God.

Which is the problem. You don't care what anyone says, or what proof people offer. If you hold this attitude, then I'm sorry for you, because you're stuck in a rut.

You may point the same accusation at me, but I can tell you with certainty that if you provide me with a scientifically verifiable proof of God, I will believe you. If the truth is put before me I will accept it. If a theory based upon truth is put before me, I will think about it and then accept it if it is the best one, because it is based on fact, and I cannot deny that. That is what I've done with evolution.

If I evolved, what am I gonna do? Cease to exist.

Come to grips with what is real and what isn't, or deny it.

Ssenkrah Semaj
August 1st, 2005, 01:59 PM
To me it always seems like more of a immature stubborness rather than true knowledge that keeps people in the religious ranks.

Some people have the knowledge and continue to follow their beliefs. As a former man of deep faith i can tell you that religion is held unto so tightly for a multitude of reasons love, fear, hate, peace, etc, etc...I'm a believer in that people hold unto religion in most part for psychological reasons not educational...sometimes no matter how much knwoledge one person might have in terms of science *cough emily g* they will still hold onto their beliefs.

dfacto
August 1st, 2005, 02:09 PM
The conflicts between science and religion occur regularly in historical science, but never in operational science. It is unfortunate that the respect earned by the success of operational science causes many to think that the conjectural claims arising from historical science carry the same authority.

First of all, thank you for clarifying what you meant. It makes your stance far more understandable.

In relation to the quote, I think you should step back and rethink what you said. Have you heard of Galileo perhaps? A man who was nearly burned for stating facts. Heliocentrism is a fact and part of operational science. In addition to that you have to think about this a bit harder, and why the conjectural claims carry authority.

As I have said at least twice in this thread, evolution is based upon solid facts which are proven by operational science. All theories are based upon facts proven by operational science. Newton's theory of gravity is based on shit falling down, which is a solid fact that cannot be disputed.

When you have facts, and logical arguments built on top of them, it is not far fetched that those arguments could be true. When evidence exists in spades, then it is even more likely that they are true. Evolution is such a claim, with the basis being rock solid scientific fact. The structure built on top of this is theoretical, but there is a huge body of evidence out there that corroborates what the theory says. With that being said, is it so odd that people would put their money on such a theory? What is the alternative? Name any alternative that is as scientifically sound.

Or, take a theory such as the Theory of Relativity. It is a theory that is based upon solid facts, and which has a huge body of evidence supporting it. While not perfect, it is the best theory out there, and works perfectly (to a point). Evolution is just like this, only it happens to conflict with some people's religions, and gets flak over it.

WindWalker
August 1st, 2005, 02:15 PM
Well, it seems to me that you just went for it with the conclusion in mind. You want to believe in God, and evolution, so you went for whatever tied the two together. Did you stop and examine all options, such as evolution without a God? Did you try to fully understand the theory behind everything you researched?
True, very true. It's what most gap theorists and progressive creationists do, and therein lies their (and my) mistake. As I said, though, that was only the basic gist of it. I did consider the existence of God, or rather the possible lack of it. And no, at that time I did not.


I stick to evolution, without the concept of a God, because it makes perfect sense to me. I know a fair amount about evolution, evolutionary theory, and biology in particular, and I can honestly say that evolution does an excellent job of coherently tying together everything that I know without logical gaps.
Lol, do you have any idea how much I would love to be able to dismiss the idea of God's existance? It would make life so much easier. You're free from responsibility, morals, accountability, etc., except for those limited morals and the like placed by society.

But I just can't deny God's existence. Faith in something beyond yourself is not one of those things that can be explained.

dfacto
August 1st, 2005, 02:28 PM
"Anyone who does not love does not know God, because God is love." 1 John 4:8

And love is blind. ;)

emily g
August 1st, 2005, 02:29 PM
The Bible states that when Adam sinned, death came into the world, but the Gap theory, just as Progressive Creationism, would have to allow for billions of years of death and destruction long before.
A problem, I admit.
The billions of fossils found in sedimentary (even igneous) rock make far more sense, with the account of a global flood.
From http://www.talkorigins.org:

Q: Isn't the fossil record a result of the global flood described in the Book of Genesis?
A: No. A global flood cannot explain the sorting of fossils observed in the geological record. This was recognized even prior to the proposal of evolutionary theory. See the Problems with a Global Flood FAQ (http://www.talkorigins.org/faqs/faq-noahs-ark.html), the April 2002 Post of the Month A Flood Geologist Recants (http://www.talkorigins.org/origins/postmonth/apr02.html) and the Talk.Origins Archive's Flood Geology FAQs (http://www.talkorigins.org/origins/faqs-flood.html).

Even the idea of a young Earth: look at the decay and rapid reversal of Earth's magnetic field
Q: How do you know the earth is really old? Lots of evidence says it's young.
A: According to numerous, independent dating methods, the earth is known to be approximately 4.5 billion years old. Most young-earth arguments rely on inappropriate extrapolations from a few carefully selected and often erroneous data points. See the Age of the Earth FAQ (http://www.talkorigins.org/faqs/faq-age-of-earth.html) and the Talk.Origins Archive's Young Earth FAQs (http://www.talkorigins.org/origins/faqs-youngearth.html).

Q: If Earth is so old, doesn't that mean Earth's decaying magnetic field would have been unacceptably high at one time?
A: No. The Earth's magnetic field is known to have varied in intensity and reversed in polarity numerous times throughout the planet's history. See the Alleged Decay of the Earth's Magnetic Field FAQ (http://www.talkorigins.org/faqs/magfields.html).
If I evolved, what am I gonna do? Cease to exist. w00t.
Heh, I thought this was funny. I realized once that if I ever met God and he told me that he used evolution to create the world, what was I going to say?
"No, you didn't."
"Yes, I did."
"No, you didn't and I know better than you even though you're . . . um . . . God."
So I'm just going to go with what logic and science tells me until God tells me different.
Why are people so arrogant when they presume to tell God exactly what he didn't or didn't do?

Why do so many people believe a literal interpretation of Genesis? Well, again it has to do with the context and the original Hebrew text. When the word, yom (day) is used with a number AND morning and evening, it always means a literal, 24 hour day. So either Genesis 1 is true, or it isn't.
Is there just this one example, or do you have more? 'Cause I think this is pretty shaky.

emily

wassermelone
August 1st, 2005, 02:33 PM
It would make life so much easier. You're free from responsibility, morals, accountability, etc., except for those limited morals and the like placed by society.

This is funny because I am completely the opposite. If I were to suddenly know God to exist, questions of morality would become clearer as well as many other questions I have about existance. It would be nice to think theres some big pie in the sky that looks out for my soul and my well being.

But looking at it logically... that pie in the sky just ain't there.

And by the way, social contract theory is just one of the many philosophies of morality.

emily g
August 1st, 2005, 02:33 PM
Some people have the knowledge and continue to follow their beliefs. As a former man of deep faith i can tell you that religion is held unto so tightly for a multitude of reasons love, fear, hate, peace, etc, etc...I'm a believer in that people hold unto religion in most part for psychological reasons not educational...sometimes no matter how much knwoledge one person might have in terms of science *cough emily g* they will still hold onto their beliefs.
What?!?! Are you talking about me here? :)

I believe what I believe ultimately because I *choose* to, while trying to remain aware of the implications of those choices.

emily

WindWalker
August 1st, 2005, 02:48 PM
A problem, I admit.
Yes, one I had a hard time admitting.

From http://www.talkorigins.org:

Q: Isn't the fossil record a result of the global flood described in the Book of Genesis?
A: No. A global flood cannot explain the sorting of fossils observed in the geological record. This was recognized even prior to the proposal of evolutionary theory. See the Problems with a Global Flood FAQ (http://www.talkorigins.org/faqs/faq-noahs-ark.html), the April 2002 Post of the Month A Flood Geologist Recants (http://www.talkorigins.org/origins/postmonth/apr02.html) and the Talk.Origins Archive's Flood Geology FAQs (http://www.talkorigins.org/origins/faqs-flood.html).
True, there does seem to be an order to the fossil record, though it isn't entirely consistent world-wide.


Q: How do you know the earth is really old? Lots of evidence says it's young.
A: According to numerous, independent dating methods, the earth is known to be approximately 4.5 billion years old. Most young-earth arguments rely on inappropriate extrapolations from a few carefully selected and often erroneous data points. See the Age of the Earth FAQ (http://www.talkorigins.org/faqs/faq-age-of-earth.html) and the Talk.Origins Archive's Young Earth FAQs (http://www.talkorigins.org/origins/faqs-youngearth.html).

Q: If Earth is so old, doesn't that mean Earth's decaying magnetic field would have been unacceptably high at one time?
A: No. The Earth's magnetic field is known to have varied in intensity and reversed in polarity numerous times throughout the planet's history. See the Alleged Decay of the Earth's Magnetic Field FAQ (http://www.talkorigins.org/faqs/magfields.html).

I admit, the magnetic field argument is not a solid one. However, I do have problems with some dating methods still used.


Heh, I thought this was funny. I realized once that if I ever met God and he told me that he used evolution to create the world, what was I going to say?
"No, you didn't."
"Yes, I did."
"No, you didn't and I know better than you even though you're . . . um . . . God."
So I'm just going to go with what logic and science tells me until God tells me different.
Why are people so arrogant when they presume to tell God exactly what he didn't or didn't do?
;) It was meant to be funny. Hey, if I meet God one day and he tells me he used evolution, or even just pooped us all out after a good meal, heck if I'm gonna doubt it. However, even if he used evolution and Genesis is wrong, if the rest of the Bible is right, it won't matter anyways.


Is there just this one example, or do you have more? 'Cause I think this is pretty shaky.

emily
Yes, I have more, but it'll hafta wait for the moment. My boyfriend just called and is coming over, and I haven't showered yet. I've been posting between bouts of housework. More later!

Mr. Visions
August 1st, 2005, 04:55 PM
Proves nothing. A circle is two dimensional.

Now, if it said "sitteth upon the sphere", that would be something! :P

That coming from an artist is "special." The text was trying the paint a picture, hoping the reader was able to comprehend a basic illustration. If you look at a painting that someone did and it's of the Earth, it's 2 dimensional, but you get the point.

- Visions

wassermelone
August 1st, 2005, 05:05 PM
That coming from an artist is "special." The text was trying the paint a picture, hoping the reader was able to comprehend a basic illustration. If you look at a painting that someone did and it's of the Earth, it's 2 dimensional, but you get the point.

- Visions

I still don't see how the word circle implies anything more than what it says.

I also don't see how you are assuming that "the world is flat" assumes anything about the shape of it. Could be.... a circle!

Daunting
August 1st, 2005, 05:24 PM
Oh believe me I understand Ssenkrah Semaj, people hold on to it because of the things you've said and many more. Doesn't mean that they are keeping their beliefs for logical educated reasons. And I should say some rather than imply all because this just isn't the case eh.

jetpack42
August 1st, 2005, 05:37 PM
Some people have the knowledge and continue to follow their beliefs. As a former man of deep faith i can tell you that religion is held unto so tightly for a multitude of reasons love, fear, hate, peace, etc, etc...I'm a believer in that people hold unto religion in most part for psychological reasons not educational...sometimes no matter how much knwoledge one person might have in terms of science *cough emily g* they will still hold onto their beliefs.


Just as soon as you can disprove that there could be a God, you'll get all the converts.

dfacto
August 1st, 2005, 05:48 PM
Just as soon as you can prove that there could be a God, you'll get all the converts.

Unfortunately, there are so many gullible, uneducated, and needy people on this planet that you don't even need to. Bummer.

jetpack42
August 1st, 2005, 06:04 PM
LOL. That doesn't make any sense.

brokk
August 1st, 2005, 07:05 PM
Science will more often than not break a hypothesis or theory to pieces based upon close scrutiny. This is the purpose of science. This is why creationism, and beliefs, fall apart when scrutinized.

When science is shown to be mistaken, it will revise itself. This has already demonstrated itself to be true many times in the theory of evolution since it was first proposed.

Not to argue with your general ideas, but just felt I should say something about these points. Science does not work in this way. You guys seem to think that when scientific theories are "falsated" (don't know the propper term in english) they are dismissed or re-worked. This is a Karl Popper way of thinking and is not how scientists actually behave when defending their theories.
In reality, scientists will defend their constructs, 'with teeth and claws'. Like Lakatos points out, there is the core of the theory, protected by a "belt" of auxiliary hypotheses. Whenever the core of the theory is attackad, the auxiliary hypotheses kick in and defend the core of the theory.
Maybe in a Popperian wet dream a scientist will discard the thing in which he has spent so much time, energy, resources and effort (his theory or contribution to it) but in reality, a scientist will hardly ever do this. Pretending that scientists operate under popperian standards is wishful thinking.
If anything, it could be more benefial that theories are constructed as Lakatos suggests (core theory, belt of auxiliary hypotheses). Lakatos does not think in terms of "true" or "false" when analysing hypotheses, but rather progressive or degenerative (in relation to the research programme).

The difference between Lakatos thinking and Popper thinking is that Lakatos takes into the consideration the history of science, where there is hardly (if ever!) an example of a scientist or group of scientists discarding a theory because it was proven "false". They actually resort to auxiliary hypothesis to defend the core theory. If you disagree, prove Lakatos wrong by finding at least one example where someone immediatly dismissed a theory because it was proven "false".
The other author to consider here is Khun (from who Lakatos borrowed concepts, if not virtually robbed) who states that given a certain time, all theories (actually paradigms) colapse at a certain point. This would happen when the auxiliary hypothesis cannot continue to defend the core of the theory and it inevitably colapses (sorry for using Lakatos terms instead of Khun's but they are so similar and I cant remember what Khun calls them). This is where a scientist will dismiss a theory, when he can no longer resort to anything to consistantly defend it, not on the first falsating attack it recieves.
Furthermore, a theory can continue to exist and function even under falsating attacks, just as so they do not colapse it.


Creationism/I.D. will never admit or revise if it is shown to be mistaken--it will dodge and make excuses.
Scientists behave in the same way. They will never admit defeat until it is absolutely inevitable (the auxiliary hypotheses can no longer defend the core theory). Dodging and making excuses is what auxiliary hypothesis are all about!

Just my 2 cents. Has nothing to do with the main argument at hand but I thought it would be interesting to point out. Hope no one fell asleep with that one.

dfacto
August 1st, 2005, 07:23 PM
Here is the problem with your argument Broken. While it is true that originators of theories will generally, if not always defend them "to the death", this is not true of science as a field. There have been countless theories proposed and discarded, and whether or not the creators liked it or not, science left the bad ones behind and retained those that were either factually true, or were the closest to being so.

The reason that creationism cannot do that is because it is a theory and not a field. Science will discard evolution if it is proven to be false, but creationists will not discard creationism if it is proven false because it is their pet theory. Christianity, as a broader institution, could reject creationism in favor of another concept, but that is unlikely since it is not united by a relevant* driving force like science is.

Science seeks to root out the truth which is directly related to the validity of theories, whereas Christianity's goal is a devotion to a God, which has little to do with the validity of a theory, and increases the likelyhood that a theory supporting the doctrine would be retained in the face of proof to the contrary.

*relevant to evolution

brokk
August 1st, 2005, 07:33 PM
dfacto, yeah, true. I agree with almost everything you said, but the field thing sounds a bit strange to me. Science is made by scientists, who are people. Science is not some abstract entity that exists by itself (just my opinion). I dont know if it can be treated as having qualities of itself, detached from its originators, its social insertion, and not considering its history.

In any case, I was not advocating for creationism! not at all (at least not with that last post).

I was just pointing out those two posts Oregano and emily g made about how scientists discard theories.

EDIT: Yeah I see what you mean by science being a field and creationism being a "pet theory". Hmm... while I agree to this, what I meant was, every scientists theory is his own personal "pet theory". I dont know if considering the whole of science, as opposed to considering every science along with its originatior, social context, and history is possible or valid. Did that make any sense? It made some sense... in my mind : P

Prometheus|ANJ
August 1st, 2005, 07:58 PM
The most exciting phrase to hear in science, the one that heralds new discoveries, is not 'Eureka!' (I found it!) but 'That's funny ...'
- Isaac Asimov

This quote points out that although scientists may have presumptions of what they will find, good science is made when the findings are surprising (and not what was presumed).

It might be true that some like to defend their theories, but there's also a ton of people that like to rip them apart. Competition leads to improvement when it comes to both theories and lifeforms, I'd say.

If I were to write a program where simple life particles have a 95% chance of lowering their 'battle level', and a 5% chance to increase it, the number would drop for as long as they don't battle. As soon as I allow competition, they'll start leveling up like mad.

brokk
August 1st, 2005, 08:21 PM
The most exciting phrase to hear in science, the one that heralds new discoveries, is not 'Eureka!' (I found it!) but 'That's funny ...'
- Isaac Asimov

This quote points out that although scientists may have presumptions of what they will find, good science is made when the findings are surprising (and not what was presumed).

This kind of agrees with how Lakatos views the progress of science:

Lakatos wanted to show that adjusting and developing a protective belt is not necessarily a bad thing for a research program. Instead of asking whether a hypothesis is true or false, Lakatos wanted us to ask whether a research program is progressive or degenerative. A progressive research program is marked by its growth, along with the discovery of stunning novel facts. A degenerative research program is marked by lack of growth, or growth of the protective belt that does not lead to novel facts.

About scientist who like to rip appart theories, mm, don't know if I agree with that. Never heard of such a case really. Hmm.. I should look more...
Maybe people like formulating stuff, defending it, and attacking neihboring theories.

About games, check it out! Its a mushroom's life!
http://a.parsons.edu/~joseph/k2/gameoflife/

emily g
August 1st, 2005, 08:44 PM
bRØk3n_sPiRiT, I agree that scientists are human too and will sometimes let their egos get in the way, but you make several sweeping statements that I cannot agree with.

You say: The difference between Lakatos thinking and Popper thinking is that Lakatos takes into the consideration the history of science, where there is hardly (if ever!) an example of a scientist or group of scientists discarding a theory because it was proven "false". They actually resort to auxiliary hypothesis to defend the core theory. If you disagree, prove Lakatos wrong by finding at least one example where someone immediatly dismissed a theory because it was proven "false".
To which I quote from http://en.wikipedia.org/wiki/History_of_general_relativity:
Since the field equations are non-linear, Einstein assumed that they were insoluble. He was disabused of this notion in 1916, when Karl Schwarzschild sent him an exact solution for the case of a spherically symmetric spacetime surrounding a massive object in spherical coordinates. This is now known as the Schwarzschild solution. Since then, many other exact solutions have been found. . . .and
In 1922, Alexander Friedmann found a solution in which the universe may expand or contract, and later Georges Lemaître derived a solution for an expanding universe. Einstein did not believe in an expanding universe, and so he once again edited the field equations, adding in a cosmological constant Λ. . . .

This permitted the creation of steady-state solutions, but they were notorious for being unstable: the slightest deviation from an ideal state would still result in the universe expanding or contracting. In 1929, Edwin Hubble found evidence for the idea that the universe is expanding. This resulted in Einstein dropping the cosmological constant, referring to it as "the biggest blunder in my career".

Einstein didn’t seem to have a problem admitting when he made mistakes and someone pointed them out to him. After all, these are his theories, he should have been fighting 'with teeth and claws,' right?
Yet he didn't. He accepted it when others corrected him. In fact, by incorporating Schwarzschild's solution, he was able to calculate the observed perihelion shift of Mercury--a big deal in the development of general relativity.

emily

stoph
August 1st, 2005, 09:07 PM
man this is getting so massive! great rebuttals, dfacto, Oregano and emily g, you are indeed worthy opponents :}. since i am only home from school to work on my art pracs, i wont give an extensive response now, but i will make one or two notes.

1. (this is particularly geared towards Oregano) - how am i supposed to present evidence in support of ID if it is secular science? im no scientist myself, and to be frank i havent found any secular sources refuting evolution, and this is why i quote creationists as their studies are the only published work i can access. sorry if this isnt good enough, but i pose the question - are you saying that the day a scientist finds faith (be it Christianity or not) is the day that they automatically place themselves in the "unreliable, lets-chastise-them" category? again i make the point that, if anything, secular materials (such as talk-origins) are overtly opposed to creationism, and often make snide, tongue-in-cheek remarks in relation to it, which of course implies a completely subjective stance on the matter (well, that is my take on it..)

2. can we discuss organic complexity a little more? im still not convinced that this has been thoroughly dealt with. thoughts on the matter?

brokk
August 1st, 2005, 09:17 PM
emily g, I haven't read much on Einstein's works or anything in the physics area for that matter, but I'll try to address the issue here:

You are quoating auxiliary hypotheses or components of a broader theory (theory of general relativity).
Scientists do not defend auxiliary hypothesis 'with teeth and claw' in the same fasion as they would defend the core of the theory.
It seems that those examples are not directed at the core but at aspects of the theory of general relativity. There is no need to fight them as long as the core maintains consistancy, and helps to do this with auxiliary hypothesis (Einstein's posterior reformulations).
A core theory is not 'just a theory'. Its more than that. Its broader, its a collective, in some ways analogous to the concept of paradigm in Khun.

As mentioned earlier, a theory can exist and still function, even though it under attack. What is important here is the consistency of the core theory, and its capacity to resolve certain problems. When this is no longer possible, the theory generally colapses (or in Khun's terms, enters the crisis stage).

Take everything I said with a grain of salt, I should seriously review this stuff. But my point is that you quoted attacks on aspects of a theory, which does not compromise the integrity of the core (no need for heavy defence by auxiliary theories) and even if it was the case, the general theory of relativity still operates, which indicates that a theory can be under attack and still operate (again, no need for heavy defence).

S.C. Watson
August 1st, 2005, 09:36 PM
1. (this is particularly geared towards Oregano) - how am i supposed to present evidence in support of ID if it is secular science?

That is a challenge isn't it?

im no scientist myself, and to be frank i havent found any secular sources refuting evolution, and this is why i quote creationists as their studies are the only published work i can access.

Perhaps there's a reason for this? If there the theories of creationists and ID proponants had merit, you would find them. However, we can see that they are lacking. When examined closely, they don't hold up against the overwhelming amounts of data provided by those evil secular scientists :rendered:

sorry if this isnt good enough, but i pose the question - are you saying that the day a scientist finds faith (be it Christianity or not) is the day that they automatically place themselves in the "unreliable, lets-chastise-them" category?

This is the second time you've posed this question. To reiterate, no. Belief in a faith, whatever faith, is irrelevant to science. This is a misunderstanding of creationists and is used as a cruch as to why their theories are shown as false instead of looking at the hard science that disproves them.

However, when a scientist adjusts the facts to support his theory, instead of adjusting his theory to support the facts*, we have a problem. Science does not work this way - you can't screw with the facts. When you do, as the creationists and the ID proponants do, they are misrepresenting themselves, and pushing an agenda (creationism) instead of following the scientific method.

Extraordinary claims require extraordinary evidence. None has been provided by either the Creationist or ID camp. This is a problem.

*a fact being something that is unquestionably establish. Say, an apple falls to the ground when you let go of it. The *theory* explains how we think this has happened, and tries to support what we see and duplicate in the lab. In essence, what the creationists are doing is saying that the apple did not fall when it was dropped.

again i make the point that, if anything, secular materials (such as talk-origins) are overtly opposed to creationism, and often make snide, tongue-in-cheek remarks in relation to it, which of course implies a completely subjective stance on the matter (well, that is my take on it..)
I'd very much like to see where they have made these comments. If they have, that is unfortunate. But again, I'd like to see them.

brokk
August 1st, 2005, 09:36 PM
I notice that in the link you posted Einstein had to change approaches many times do to inconsistencies. These would be inconsistencies but in relation to aspects of the "theory".
Einstein already had a barrage of specific knowledge before embarking on this investigation. He shifted approaches and formulations but the knowledge he had that made this possible remained consistent. This is what I was reffering to with core theory, an attack directly at this barrage of knowledge (a lot of precepts in physics and other disciplines) or "World View" or even "Paradigm" (with some licence), is what an attack to the core theory would be. This type of knowledge is the theoretical grand frame that makes the subsequent researches possible, even if in those researches one changes approach, formulations, etc. This encompassing knowledge collective is not something you discard that lightly.

Prometheus|ANJ
August 1st, 2005, 09:55 PM
There's many cases of scientists accepting that they were wrong, but there's probably a lot of examples of really stubburn guys too.

What matters though is how succesful the theory is to the general scientific community. The scientist who made the theory may be dead since long along with his bias. What he thinks is not relevant.

There's a lot of examples of major theories getting discarded or modified if you look at it from a larger timescale. Ptolemaios, Copernicus, Newton...


About scientist who like to rip appart theories, mm, don't know if I agree with that.
We may not be scientists, but take a look at this thread.

Proving someone wrong is very appealing to most humans, cuz it gives her a feeling of superiority. Making a name for yourself in the scientific community is also a driving force, and you can't do that unless you come up with something new that survives scrutiny.

stoph
August 1st, 2005, 09:57 PM
That is a challenge isn't it?

no, no challenge, its just i didnt get around to quoting you (as you spoke on this topic earlier).


Perhaps there's a reason for this? If there the theories of creationists and ID proponants had merit, you would find them. However, we can see that they are lacking. When examined closely, they don't hold up against the overwhelming amounts of data provided by those evil secular scientists :rendered:

i never said that secular science was evil, youre making me out to be an overzealous, fire and brimstone guy, which i dont feel is fair.


This is the second time you've posed this question. To reiterate, no. Belief in a faith, whatever faith, is irrelevant to science. This is a misunderstanding of creationists and is used as a cruch as to why their theories are shown as false instead of looking at the hard science that disproves them.

i apologise for being repetative, albeit thorough. thankyou for giving further clarification on the matter. i did not intend it to be an argument, i was just asking as to whether or not these were your pretences for dismissing my sources. thanks for clearing that up.


However, when a scientist adjusts the facts to support his theory, instead of adjusting his theory to support the facts*, we have a problem. Science does not work this way - you can't screw with the facts. When you do, as the creationists and the ID proponants do, they are misrepresenting themselves, and pushing an agenda (creationism) instead of following the scientific method.

Extraordinary claims require extraordinary evidence. None has been provided by either the Creationist or ID camp. This is a problem.

*a fact being something that is unquestionably establish. Say, an apple falls to the ground when you let go of it. The *theory* explains how we think this has happened, and tries to support what we see and duplicate in the lab. In essence, what the creationists are doing is saying that the apple did not fall when it was dropped.

ill address this in a later post.

I'd very much like to see where they have made these comments. If they have, that is unfortunate. But again, I'd like to see them.

again ill address this in another post. rest assured, such instances exist in these sites, as i myself have seen them.

ok better get back to school!

brokk
August 1st, 2005, 10:20 PM
What matters though is how succesful the theory is to the general scientific community. The scientist who made the theory may be dead since long along with his bias. What he thinks is not relevant.
Of course, I agree. A theory in the general sence that I meant it was not just an isolated formulation, I meant theory in the very broad aspect, like Paradigm. This is not sustained by only one person, its likely to be endorsed by an enourmous part of the cientific comunity.

There's a lot of examples of major theories getting discarded or modified if you look at it from a larger timescale. Ptolemaios, Copernicus, Newton...
Yeah, this is what I was trying to reffer to. This is too broad of a topic to write it all here, in this link it is far better explained than I could, especially at the part that says "Coherency"
http://en.wikipedia.org/wiki/The_Structure_of_Scientific_Revolutions



We may not be scientists, but take a look at this thread.

Proving someone wrong is very appealing to most humans, cuz it gives her a feeling of superiority. Making a name for yourself in the scientific community is also a driving force, and you can't do that unless you come up with something new that survives scrutiny.
I agree to this as well. I meant that, I haven't heard of a case where a scientist specifically sets out to attack other theories with no formulations of his or her own. I think I may have misinterpreted your first post.

emily g
August 1st, 2005, 10:28 PM
bRØk3n_sPiRiT, I don't see how you can definitively drawn a line between what is a "core theory" and what is an "auxiliary hypothesis." Almost any hypothesis can be said to belong to a larger theory, ultimately culminating in the grand "theory of everything."

This is what I was reffering to with core theory, an attack directly at this barrage of knowledge (a lot of precepts in physics and other disciplines) or "World View" or even "Paradigm" (with some licence), is what an attack to the core theory would be. This type of knowledge is the theoretical grand frame that makes the subsequent researches possible, even if in those researches one changes approach, formulations, etc. This encompassing knowledge collective is not something you discard that lightly.
Ok, this is a better definition of what you consider to be a “core theory.” With that said, my response toThis encompassing knowledge collective is not something you discard that lightly.is “No kidding.”

Of course no one would discard something like this lightly. The bigger, more over-arching, and/or more complex a theory is, the longer it can take to study and evaluate proposed alternatives. No one would ever “immediately dismiss” something like this. The proof would have to be really, really amazing and obvious for something like that to occur.

And yet you accuse scientists of dragging their feet and relying on “alternate hypotheses” when faced with a question of this magnitude. Well they should! If the question is really that big, they should take their time about it.

Plus, you give the impression that this sort of question happens all the time! It’s not every day that a theory comes along that upends something like this. Plus, hardly ever is it necessary to throw out a whole theory. Usually only part of a theory needs to be thrown out or revised.

So what is the problem? It seems like you are merely accusing scientists of being unwilling to “immediately” accept a theory that overturns and changes everything.

From the link you posted: The majority of the scientific community will oppose any change of mind, and, emphasizes Kuhn, they should.
emily

S.C. Watson
August 1st, 2005, 10:29 PM
no, no challenge, its just i didnt get around to quoting you (as you spoke on this topic earlier).

Sorry, I was meaning it was a challenge, as in difficult or trying, not as in gauntlet accross the face :rendered:

i never said that secular science was evil, youre making me out to be an overzealous, fire and brimstone guy, which i dont feel is fair.

Sorry again. I was being toungue-in-cheek here. I'm home from work and a tad punchy.

i apologise for being repetative, albeit thorough. thankyou for giving further clarification on the matter. i did not intend it to be an argument, i was just asking as to whether or not these were your pretences for dismissing my sources. thanks for clearing that up.

Again, no worries. I was just mentioning it was the second time this had been addressed. No feathers were ruffled.

ill address this in a later post.

Please address this, as my typing in the previous is a tad wanting. I've made a couple of edits for clarity in the hopes of cutting confusion and avoiding unnecessary goose chases:
*a fact being something that is unquestionably establish. Say, an apple falls to the ground when you let go of it. The action of the apple falling is considered the fact, or the evidence. The *theory* explains how we think this has happened, and tries to support what we've seen and attempts to duplicate it in the lab and submit for peer review. But the fact is that the appel fell. In essence, what the creationists are doing is saying that the apple did not fall when it was when it was released.

It's a poor analogy, I freely admit. But it's the best I can come up with at the moment.

again ill address this in another post. rest assured, such instances exist in these sites, as i myself have seen them.

ok better get back to school!
Good luck!

emily g
August 1st, 2005, 10:53 PM
Emily G: I really enjoy reading your posts, very informative , well-worded and solid arguments that appear to be pure, sensible logic and science.
Am I right in thinking you were one of the people who was sitting with us at the Chinese restaurant with the big round table on the night before the start of the San Francisco workshop?
Shame I didn't get a chance to properly talk to you, you sound like a very intelligent and interesting person.
I didn't want to miss this among all my typing. Thank you very much for your kind words. Yes, I was the girl with the long blond hair--probably 2 or 3 places to the right of you at that table. Perhaps we can get another chance to chat someday in person.

I enjoy everyone's contributions to this thread. Everyone seems to be thinking things out and posting good arguments. It's a pleasure to participate.

best,
emily

brokk
August 1st, 2005, 10:55 PM
emily g:

bRØk3n_sPiRiT, I don't see how you can definitively drawn a line between what is a "core theory" and what is an "auxiliary hypothesis." Almost any hypothesis can be said to belong to a larger theory, ultimately culminating in the grand "theory of everything."

Mmm... not exactly. It would culminate in the grand "theory of everything", but this is a paradigm itself. It has its limits (I think!) Its a certain state of how the world is presently viewed, like a supergrand theory. This is the "core theory" I was reffering to. Like I said... I need to review this stuff myself... if you want to know more about it, check out Imre or Imri Lakatos.

Of course no one would discard something like this lightly. The bigger, more over-arching, and/or more complex a theory is, the longer it can take to study and evaluate proposed alternatives. No one would ever “immediately dismiss” something like this. The proof would have to be really, really amazing and obvious for something like that to occur.

The grand anomalie in Kuhn's analysis! That really amazing proof is a grand anomalie (or something like that, its more than a regular anomaly) is the ultimate evidence that collapses the theory! (shifts it into the crisis stage actually).

Plus, you give the impression that this sort of question happens all the time! It’s not every day that a theory comes along that upends something like this. Plus, hardly ever is it necessary to throw out a whole theory. Usually only part of a theory needs to be thrown out or revised.
No no, not at all! I'm sorry if I caused the impression that it happens all the time! Quite the contrary actually. I cant remember if either Kuhn or Lakatos mentioned it, but one of them said it had happened very very few times in history. One was with the paradigm shift of Maxwellian electromagnetic worldview to the Einsteinian Relativistic worldview, following on the Einstein example. Here is a link and a quote:

http://en.wikipedia.org/wiki/Paradigm_shift
Again, for early 20th century physics, the transition between the Maxwellian electromagnetic worldview and the Einsteinian Relativistic worldview was not instantaneous nor calm, and instead involved a protracted set of "attacks," both with empirical data as well as rhetorical or philosophical arguments, by both sides, with the Einsteinian theory winning out in the long-run.
You are correct, only a part of a theory needs to be thrown out or revised, that would be an auxiliary hypothesis (I think).


So what is the problem? It seems like you are merely accusing scientists of being unwilling to “immediately” accept a theory that overturns and changes everything.
Lol, no, thats not my accusation! : P
I just felt like some comments seemed popperian, and I thought it would be interesting to present alternative ideas to the same issues.
No problem really, I thought it was a great way to exchange ideas.

Again, take everything I said with a grain of salt. I have terrible grammar, I misuse concepts, and I mix up notions from some authors in a very amateur way. If you really want to know more about this stuff and why I agree to these ideas check out Popper, Khun, Lakatos, and Feyerabend. I agree mostly with Khun and Feyerabend. Lakatos is at times a virtual rip off of Khun, and Popper is the guy they are all influences by and aim their critics : P


EDIT:
And yet you accuse scientists of dragging their feet and relying on “alternate hypotheses” when faced with a question of this magnitude. Well they should! If the question is really that big, they should take their time about it.
Of course! Sorry if it seemed like I was saying otherwise. If you look back, in one of my posts I agreed that having a safety belt of auxiliary hypotheses is actually a good thing! I admit I still partially think in terms of "true" or "false", but I think that "progressive" and "degenerative" are more accurate concepts (Lakatos).


Whew I'm beat by this!

brokk
August 1st, 2005, 11:20 PM
Err... emily / prom, I dont know why but I'm getting the feeling you may imply I'm out to argue pointlessly or something (paranoia?). It wasn't ill will, just saw what seemed like an interesting point to raise and discuss a little as a sidecomment to the general debate. It was pretty great, but I'm going to sleep now, thank you guys a lot.

emily g
August 1st, 2005, 11:31 PM
bRØk3n_sPiRiT, no worries at all. I appreciate your clarifications. I think I see why your initial post was difficult to understand.

In the first place, you didn’t really define what a “core theory” would be. This gives the impression that the theory can be of *any magnitude* (as long as it has some auxiliary hypotheses, which just about every theory does).

Because of this initial confusion, your words regarding science and scientists come out sounding somewhat critical and accusatory.

Things such as:
Science does not work in this way. You guys seem to think that when scientific theories are "falsated" (don't know the propper term in english) they are dismissed or re-worked. . . .

In reality, scientists will defend their constructs, 'with teeth and claws'. . . .

Maybe in a Popperian wet dream a scientist will discard the thing in which he has spent so much time, energy, resources and effort (his theory or contribution to it) but in reality, a scientist will hardly ever do this. Pretending that scientists operate under popperian standards is wishful thinking. . . .

This is where a scientist will dismiss a theory, when he can no longer resort to anything to consistantly defend it, not on the first falsating attack it recieves. . . .

Scientists behave in the same way. They will never admit defeat until it is absolutely inevitable (the auxiliary hypotheses can no longer defend the core theory). Dodging and making excuses is what auxiliary hypothesis are all about!

These words make a lot more sense when you know that "theory" is meant to refer to a large, over-arching paradigm.

Also,
So what is the problem? It seems like you are merely accusing scientists of being unwilling to “immediately” accept a theory that overturns and changes everything.

Lol, no, thats not my accusation! : P

This is where I got that idea, especially in your use of the word “immediately:”
. . . Lakatos takes into the consideration the history of science, where there is hardly (if ever!) an example of a scientist or group of scientists discarding a theory because it was proven "false". They actually resort to auxiliary hypothesis to defend the core theory. If you disagree, prove Lakatos wrong by finding at least one example where someone immediatly dismissed a theory because it was proven "false".
But everything's good now. I understand what you were trying to say. It is actually an interesting thing to think about, so I'm glad I got the chance to learn more about it.

best,
emily

brokk
August 1st, 2005, 11:50 PM
Cool! : P
Hey thanks for pointing out my mistakes there, I should have really clarified from the beginning what I meant with those concepts, I just started rammbling out of my head assuming I was expressing things correctly but I forgot to elaborate a lot on the concepts. Now I know for future situations and will keep it in mind.

Yeah paradigms rock my socks haha : P

Ok I really really need to be catching some sleep now.
Peace : P

NoSeRider
August 2nd, 2005, 04:26 AM
I believe people came from a monkey's ass, and that we evolved from pond scum......and I believe God did that deliberately to teach us humility.

I also believe that for every day God created the heavens and the earth that was a billion years. God created the Earth in 7 days. The Universe is about 7 Billion years old from start of the Big Bang....sounds right to me.

The Bible claims Adam was created from clay. I hardly see too much difference between that and evolving from pond scum.....and Adam was created on the 8th day by the way.

That creationism thingy just makes us sound a little too special. Personally, I think people should be pegged down a notch or two.

In actuality I see alot of parallels between Genesis and Evolutionary theory.

I also believe that your beliefs have no more merit then my beliefs and vice versa......because you can't prove it one way or another.

And I don't believe that God put all these fossils on the Earth to confuse us or doubt our Faith.....I just believe clues were left around for us to discover and make us realize how complicated and amazing things really are.

dfacto
August 2nd, 2005, 05:46 AM
2. can we discuss organic complexity a little more? im still not convinced that this has been thoroughly dealt with. thoughts on the matter?

What would you like to know?

ShadeOfDawn
August 2nd, 2005, 11:10 AM
...

I also believe that for every day God created the heavens and the earth that was a billion years. God created the Earth in 7 days. The Universe is about 7 Billion years old from start of the Big Bang....sounds right to me.

...


i dont really want to get into this cause im too easily drawn into debates like this

but the universe is about 13 billion, not 7.

sorry.

brokk
August 2nd, 2005, 11:19 AM
A resolution to the Creationist vs Evolutionist conflict
And why neither will "win" over the other

The relevance of the concept of paradigm to this discussion
Thomas Khun, in his publication The Structure of Scientific Revolutions (http://en.wikipedia.org/wiki/The_Structure_of_Scientific_Revolutions), presents the concept of paradigm.
Just what is exactly a paradigm is dificult to define in only one way. At one point Khun stated that there were over 20 different definitions of what a paradigm is. But to resume the idea: a paradigm is a sort of World View. Its a grand collective of knowledge and theories enforced by many different disciplines. Its like a Grand Theory that governs all the little theories. A paradigm is embraced and supported by an enourmous part of the scientific community. What is important here is that scientific investigation is possible because of this current World View, the evidence is seen in through the perspective of this World View. Two different people, who look at exactly the same evidence will draw completly different conclusions. Yet the physical evidence is 'the same'.

An analogy to this is the bunny-duck example: http://en.wikipedia.org/wiki/Paradigm_shift (the image of that weird creature).

When Kuhn presented the concept of paradigms, he ment it exclusively for science. During the years, a lot of people have taken the notion of paradigm and applied it to other areas other than science. Its important to remember that the mechanisms of these "other" paradigm types does not mean they are exactly like Khun's paradigms, and that Khun never intended for the concept of paradigm to be used outside of science.

That being said, I believe some licensce can be taken to use the concept of paradigm to our discussion of Creationism and Evolution, at least as an analogy.

Let's say that there is a Creationist paradigm, and an Evolutionary paradigm, and there are supporters of both. Since they are like grand World Views, it is highly unlikely that either is going to be shattered. Supporters of both paradigms are using attacks on the other, and both defend themselves with many auxiliary hypothesis (I'm not saying this in accussatory way or implying its a bad thing, on the contrary).


Going back to the bunny-duck example, which interpretation is the correct one?
Neither, in an exclusive or abstracted way. The function of a paradigm or grand theory, is that it provides explanations to world phenomenons. It makes the formulation of certain questions (research) even possible.
There will be some questions that arrise that a paradigm cannot answer. These are known as anomalies. Still, this does not mean that a paradigm will cease to operate. As long as it can still maintain general consistency, everything's ok and safe. Yet, the anomalies start accumulating over time. Either they are dealt with by formulating auxiliary hypothesis, or they are not addressed at all (the paradigm has no answer to them at the moment). If the anomalies start being very numerous and specific, the paradigm will start to have issues when attempting to answer questions. When the anomalies are too numerous, or when a Great Anomalie (or something like that) appears (attacks the very core of the theory and there is no possible defense), the paradigm enters the crisis stage. When the crisis stage is resolved, a Scientific Revolution occurs. This is important because this is where progress really lies.

Back to our discussion. Both supporters of Creationism and Evolution have presented anomalies to each other. As mentioned, this does not mean you will put into crisis the paradigm you are attacking. Auxiliary hypothesis (explanations to these anomalies) can be made, or even further, they dont even have to be addressed!
An example of some anomalies presented to the Evolutionist paradigm (dont know if it happened in this discussion, but its a common example):
1) "Evolution cannot be recreated in the same fashion as it happened 'for real', and therefore it cannot be regarded as a propper scientific formulation"
2) "Evolution is not directly observable".
The responses: either resort to an auxiliary explanation ("there is no need to witness it on a specific scale, its mechanisms can be observed at a larger scale) or simply not address the problem ("science cannot explain everything, thats why its not like religion").
Examples of anomalies presented to the Creationist paradigm:
1)"The fossil record is incompatible with the Bible, on which Creationism is founded"
2)"The carbon-dating of certain things does not match the years of creation presented in the Bible"
The response: auxiliary hypothesis ("the world was created in seven days, this is a metaphore for seven billion years") or simply not address the problem (I believe in God, I dont need proof, or question Him).

See, no paradigm is collapsing the other, they are both still functioning, even though there are anomalies to both. They both provide explanations based on the same observable evidence.

Many people believe that science progresses by an acumulation of empirical data or knowledge. This is called logical positivism in science, and is supported by scientists like Karl Popper. The serious flaw in this approach is that supporters of this notion of progress in science fail to consider the history of science, the historical knowledge we have of scientific happenings since there is record.
Some people, some being former students of Popper, set out and took a look at this historic record, and saw that never in history did science opperate like this, and that progress was not made during the phase of data acumulation. One of these people is Thomas Khun. After considering the historical record of science, Khun proposed that science progressess based on paradigmatic revolutions. His paper on the subject became a landmark in epistemology and science in general.
Other authors that considered the historic record of science are Imre Lakatos and Paul Feyerabend. Both of them have their own formulations, but there is a common notion that can be said to be shared by the three of them, Khun Lakatos and Feyerabend: science does not progress by empirical data acumulation, as it was believed before by the logical positivist movement. Instead, science progresses when it resolves "crisis" stages. This means that when you can no longer explain for certain phenomenons with your current World View, a new World View is needed that can provided explanations

Both the Creationist and Evolutionist paradigms here can still provide explanations for the same phenomena, in their own fashion, according to their World View. Neither of them is in crisis, and its unlikely that they will enter crisis because of the things mentioned earlier. A World View can still operate even though its full of anomalies and stuff it can't resolve.

In regards to the Creationist vs Evolutionist argument here, if science is what we are considering the problem here is that you are both being religious about it, and not scientific. If there were sufficient anomalies or a Grand Anomalie to really endanger the Creationist paradigm, the creationist would resort to something like "whatever, I still believe in God" because its insterted in a broader, non-scientific "paradigm" that is religion.
But the evolutionists here seem to be doing the same thing with the idea of scientific progress. Even if the creationists could present overwhelming anomalies or a Grand Anomalie, the evolutionists might say "science cant explain everything but science is why we have progress in the first place". You see, this is faith in science, or faith in the possibilities of science, which could also be reffered to as logical positivism, treating science as something abstracted and detached from its historical record and its insertion in its social contexts. Again, I dont mean these things in an acussatory way or implying that "they're wrong". I point them out to show the interesting idea, that science, no matter how rational it may seem, is full of non-scientific ideas that support it. Particularly, the idea of progress. If anything, I honestly believe this makes science richer, because it brings it closer to being what it really is: a human development. Why search to detatch it from humanity and its human components? But this is completly a different matter.

Even though Khun never intended for the concept of paradigm to be used outside of science, I think the analogy of Khun paradigms to the Creationis and Evolutionist debate is valid at least as a way of saying:
nobody will "win" with this one.
Or better yet, we all win, each according to our own personal World View.

Sorry if anything here seemed like an attack or an accusation, its not how it was originally meant. I apologize for the grammar and use of concepts that may be used incorrectly, but the general intention was to try and reach some comon ground in this never ending war.

Peace.
C ya!

dfacto
August 2nd, 2005, 11:47 AM
bRØk3n_sPiRiT
A resolution to the Creationist vs Evolutionist conflict
And why neither will "win" over the other

...


So what's your point Broken? You have just made an argument that leads nowhere, since it is a blanket statement that covers every field and, in fact, humanity in general. We're humans, so we'll use our human faith system which we apply to everything.

Faith that the sun will rise. Faith that there is no poison in our food. Faith that you will live through the day. Faith that gravity will keep me stuck to the ground.

What you're saying is that both creationism and science are based on faith in end effect, which is a no-brainer. Our whole existance is based on faith in various things which we hold to be true through repeated common experience and observation. To say that religion and science are not faith based is a no-brainer, and doesn't prove or disprove anything, or bring anything to the argument.

Once you accept the faith inherent in life and why it is there you see that the "why" of faith isn't important. The why goes without saying. What you need to examine is the "what". What are the factors, proofs, etc that lead the person to that faith.* Since we all have the same faiths in the reality of our world, those "whats" can be examined according to a global standard of facts and logical arguments. The "why" will never change, because we are human and require faith to live, but the "whats" will. And that is why we are having this longwinded discussion.

*IE: Why do I believe something so deeply that I don't need to think about it, or believe in other things, like evolution, less deeply, but still with conviction. Gravity for example, is proven in ever second of my waking life and I have no reason to question it. Evolution rests upon facts which I have studied second hand, read about from numerous credible sources, checked myself to the a degree possible to someone without grants or fancy equipment, and all of which is delivered by a field which has shown repeatedly that it can get the job done. My faith in science is both unthinking (as faith is), but also based on the simple fact that I see it work every single day of my life. I don't think can remember any day where it was impossible to spot an effect of science. Even out in the middle of a forest you can look up and see the jet contrails (at least where I lived). This is the kind of proof that beats itself into you with finality, because it is everpresent. If something like this, with a trackrecord of deserving faith, comes up with a new theory, then isn't it worthy of a look? Isn't it worthy of a fair amount of faith? If that theory then turns out to make perfect sense when matched to everything else that you know, then doesn't it deserve even more faith?

I think it does.

Also, good stuff about the revolutionary changes of science, but I don't think that is quite true on small scales. It is true for the very large theories, but not all of science is made up of such big structures that can stand or fall. There are lots of small theories that don't ever get bloated enough to be torn down in a "revolution"

EDIT: And would you please stop posting stuff from those two guys? You've sidetracked a perfectly fun discussion on the mechanics of evolution and turned it into a matter of faith. You even made me get moderately philosophical on you. Blah. :S

Ssenkrah Semaj
August 2nd, 2005, 12:17 PM
EDIT: And would you please stop posting stuff from those two guys? You've sidetracked a perfectly fun discussion on the mechanics of evolution and turned it into a matter of faith. You even made me get moderately philosophical on you. Blah. :S

And I for one am glad that Broken Spirit did, I very much enjoyed your philosophical statement and found it very enlightening.

brokk
August 2nd, 2005, 12:42 PM
dfacto:

So what's your point Broken?
Answer: A resolution to the Creationist vs Evolutionist conflict
And why neither will "win" over the other ; P
How? by making an analogy with Khun's paradigms to the consideration that Creationism and Evolutionism could be thought to work in a similar way, and that's why this discussion won't see one "winning" over the other.

You have just made an argument that leads nowhere, since it is a blanket statement that covers every field and, in fact, humanity in general.
Mmm... I don't think its very circular what I posted... my argument is not mainly in relation to how faith drives human actions, but how paradigms maintain consistency, even when under attack. Please re-read what I wrote.

What you're saying is that both creationism and science are based on faith in end effect, which is a no-brainer.
Again, no, not exclusively. Creationism aspires as a discipline seems to aspire to the status of science but the way in which it appears to adhere to the scientific method shows it to be more of a pseudoscience (I think).
Evolutionism is scientific, BUT, what I was arguing is the approach to which you support evolutionism: my argument was against logical positivism in science, and in favor of an approach that consideres the notion of progress diferently (ie: khun, lakatos, feyerabend).

and doesn't prove or disprove anything, or bring anything to the argument.
heh, I'm not looing to prove or disprove anything ; P
I preffer to try to think things as "progressive" or "degenerative" (Lakatos rolling in his grave) ; P
Considering things from a more human perspective rather than logical positivist seems to me more 'progressive', but thats only my opinion.

The "why" will never change, because we are human and require faith to live, but the "whats" will. And that is why we are having this longwinded discussion.
Of course! you just hit the nail of my argument, the bunny-duck example. I was just presenting the ideas that things depend on how you look at things, even "truth". I understand "truth" as something dependant of your current world view. I dont know what else to say... please look at the bunny-duck example again, it relates to how different views provide different explanations on the same phenomena: http://en.wikipedia.org/wiki/Paradigm_shift

If that theory then turns out to make perfect sense when matched to everything else that you know, then doesn't it deserve even more faith?

I think it does.
I think so too, but progress is dynamic, not a static state of knowledge accumulation and confirmation.

Also, good stuff about the revolutionary changes of science, but I don't think that is quite true on small scales. It is true for the very large theories, but not all of science is made up of such big structures that can stand or fall. There are lots of small theories that don't ever get bloated enough to be torn down in a "revolution"
Wheh! glad we could agree on something! : P
I think its true for large scales too, thats what I've been saying. The "small" theories are the auxiliary hypothesis of a bigger "theory" (world view, paradigm). You see, "small" theories do not stand by themselves isolated from everything else, you require a certain 'state of mind' to be abble to support them. This 'state of mind' is an encompassing knowledge collective that could be called a paradigm.

EDIT: And would you please stop posting stuff from those two guys? You've sidetracked a perfectly fun discussion on the mechanics of evolution and turned it into a matter of faith. You even made me get moderately philosophical on you. Blah.
Mm... this one seems different. Ok, here goes. My intention was not to sidetrack the main discussion, actually the main discussion still continued with Oregano and Stoph. If you look back, in several posts I mention that this was only to add something as a sidecomment, to a point I saw interesting to address (how scientists discard theories or components of the theories).
I fail to see why citing Khun and Lakatos upsets you :[ in order to address the sideissue, it was kinda necessary to do so. The side discussion seemed to be more specifically about science (or more accurately epistemology) and I have a certain opinion on the subject. My opinion is based on several key concepts of these people, so its propper that I should say from where I'm getting these ideas. These guys are known scientists, science historians, and epistemologists, and their works have been enourmous contributions and landmarks to science and epistemology.


Dont know if its worth much, but the intention of this was to try to reach a bit of common ground. I'm sorry if you think I'm acting on bad faith :[

EDIT: if it bothered you that I quoated Khun and Lakatos.... oh man... those are the "normal" guys.... wait to I start quoating Feyerabend! ; P
j/k, but really, dont get stressed about this stuff. I only quoted so I could show where I was taking these ideas from in case anybody was interested.

NoSeRider
August 2nd, 2005, 12:48 PM
13.5 Billion years......phfff.

Come on, face it. They're guessing.

OK, every 2 billion years equals a day....close enouph.

emily g
August 2nd, 2005, 12:48 PM
bRØk3n_sPiRiT, very interesting post. I noticed that you were very careful with your words this time. :)

Don't worry dfacto, I'm sure we'll get back into the "mechanical" science when some people return to post their responses. In the meantime, it's something interesting to think about.

emily

brokk
August 2nd, 2005, 01:06 PM
Semaj and emily, glad you guys found it interesting : P
cheers

dfacto, I see this "sidediscussion" has taken over a lot of the thread, but I think that the main discussion is pretty heated so it will probably continue once people return.

13.5 Billion years......phfff.

Come on, face it. They're guessing.

OK, every 2 billion years equals a day....close enouph.
Lol, cool. Made me smile :) : P

Ssenkrah Semaj
August 2nd, 2005, 01:20 PM
13.5 Billion years......phfff.

Come on, face it. They're guessing.

OK, every 2 billion years equals a day....close enouph.

Yeah but the hebrew god created the Earth in 1 day..not 6 or 7.. then he created man than the animals....but evidence shows that the dinosaurs came first soooo...phffff....dilemma dilemma....stupid fossil record. Just ignore all that you know, what is real in your heart, it's not like people have believed in god(s) before- that we now know to be myth....We can't be as blind as our ancestors....can we?

dfacto
August 2nd, 2005, 01:25 PM
In regards to the Creationist vs Evolutionist argument here, if science is what we are considering the problem here is that you are both being religious about it, and not scientific. If there were sufficient anomalies or a Grand Anomalie to really endanger the Creationist paradigm, the creationist would resort to something like "whatever, I still believe in God" because its insterted in a broader, non-scientific "paradigm" that is religion.
But the evolutionists here seem to be doing the same thing with the idea of scientific progress. Even if the creationists could present overwhelming anomalies or a Grand Anomalie, the evolutionists might say "science cant explain everything but science is why we have progress in the first place". You see, this is faith in science, or faith in the possibilities of science, which could also be reffered to as logical positivism, treating science as something abstracted and detached from its historical record and its insertion in its social contexts.

This is what I was referring to in my post, not the greater mass regarding logical positivism, or the theoretical revolutions. You attempt to use faith to put both on an even playing field, which is what I took issue with, because you wield it like a weapon against both creationism and science, rather than what it really is: a fact of life.

Answer: A resolution to the Creationist vs Evolutionist conflict

As I said, you are wielding your arguments about faith in a manner which they do not support. You will NOT achieve victory in this manner, because you are attempting to deal with the "why" of the debate, rather than the "what", to go back to my previous post. You cannot win an argument without dealing with the source of the argument. The source, or the "what" (should stop using that) is the thing that will answer "why", because it is the root, and that is what you need to focus on.

And why neither will "win" over the other ; P

Exactly, and without victory there is no resolution. You say there can be no victory, which means that you're attempt at a resolution are pointless. You want a stalemate, which is really the best you will get with your methods. Hey... wait a minute... This means you're just trying to spoil all our fun! I knew it! :D

Mmm... I don't think its very circular what I posted... my argument is not mainly in relation to how faith drives human actions, but how paradigms maintain consistency, even when under attack. Please re-read what I wrote.

Yes, I should have quoted the exact paragraph that I took issue with, rather than the whole. However, even your paradigm argument can be said to lead nowhere, because it it not really an argument, at least to me. It is a statement which has no actual bearing on the evoluton vs. creationism debate because it can be applied to both, and their parent fields, thus levelling the playing field and leaving the argument right where it was before it's introduction.

my argument was against logical positivism in science, and in favor of an approach that consideres the notion of progress diferently (ie: khun, lakatos, feyerabend).

Well, ok, but what does that have to do with a debate about evolution and creationism? The revolution theory doesn't disprove scientific credibility, but rather enforces it, as it shows that science does, as a whole, strive towards the truth, and can correct itself. It is not a disproof against science, and does not even attempt to say anything about creationism, so it is therefore nothing more than an intellectual matter to contemplate separately, or in a debate about science.

please look at the bunny-duck example again

I already did, but, like the rest of your argument, I don't believe that it contributes anything significant to the argument, aside from doubt in the point of arguing itself, which I roundly condemn. I like arguing. :)


I think so too, but progress is dynamic, not a static state of knowledge accumulation and confirmation.

Yes, but that doesn't change the matter of faith in science in any way, except perhaps to insert a healthy bit of sceptisism, which one should have anyways. It's no good being gullible.

My intention was not to sidetrack the main discussion, actually the main discussion still continued with Oregano and Stoph. If you look back, in several posts I mention that this was only to add something as a sidecomment, to a point I saw interesting to address (how scientists discard theories or components of the theories).

Well, you did sidetrack it, and as I said, I don't see that track as actually exerting any influence upon the issue of evolution and creationism. It is an interesting side-note, but not fuel for the debate. In fact, it's anti-fuel, because that is what you want it to be.

I fail to see why citing Khun and Lakatos upsets you in order to address the sideissue, it was kinda necessary to do so.

See above. I have no gripe with them or what they say, but I don't feel that it is relevant.

Don't worry dfacto, I'm sure we'll get back into the "mechanical" science when some people return to post their responses. In the meantime, it's something interesting to think about.

Always true, but it's just more fun to talk about DNA and monkey ancestors. *notes that this board needs a monkey icon*

brokk
August 2nd, 2005, 02:06 PM
Lol, I dont even know how to start this new reply.

dfacto, at the risk of sounding bold, I think you misinterpretated me, my brother! :D

Let me try to post more coherently what I meant about the faith thing.

You attempt to use faith to put both on an even playing field, which is what I took issue with, because you wield it like a weapon against both creationism and science, rather than what it really is: a fact of life.
nooo... lol :D. Not only is it a fact of life, but an enriching and necessary fact of life! Here is my quote:

You see, this is faith in science, or faith in the possibilities of science, which could also be reffered to as logical positivism, treating science as something abstracted and detached from its historical record and its insertion in its social contexts. Again, I dont mean these things in an acussatory way or implying that "they're wrong". I point them out to show the interesting idea, that science, no matter how rational it may seem, is full of non-scientific ideas that support it. Particularly, the idea of progress. If anything, I honestly believe this makes science richer, because it brings it closer to being what it really is: a human development.
(I added the black remarkings there to show the part I meant).

Ok, done with that.

About everything else, I guess we just disagree!! haha : P
I honestly believe the "why" and the "what" are interdepentandt and cannot be separated in that fashion, doing so is an abstraction.

So we just have difference of opinions. About winning, leveling the debate field, taking the fun away, sidetracking, etc..... sigh... don't know about that, and really not that interested. If I did do those things, err, sorry, I didn't do it conciously. Not that its an excuse, but... oh well.... nevermind, lol.

In my own "World View" I think we both made some solid points and tripped on a few others. And it seems we wont come to more common points than these. Shall we agree to disagree? ; P

EDIT: yeah I see what you mean about posting irrelevant stuff. Seems like I'm going to do some thinking about this. It seemed relevant when I posted it, but now seeing your replies, mm, I can see where you concern is (I think). I'll try not to contribute stuff that is mostly irrelevant in the future, but I really do think that what I posted has some degree of relevancy.
Afterall.... we both know I'm out to level the playing field and spoil the fun.. ; )

dfacto
August 2nd, 2005, 02:27 PM
Shall we agree to disagree? ; P

But that's no fun. :S


And about the "why" and "what". What I mean, more clearly, is that looking at a "why" to the argument will always yield the "what" since "what" is the root. However, it reduces the "what" to a generalization, because you can't look at both "why" and "what" in depth at the same time.

The faith that people hold in something is dependant on what that something is. What is the thing? What are its properties? What does it mean? etc. These things are what must be ironed out in detail in order to prove or disprove anything. They contribute to the "why" of someone's beliefs, but the "why" is itself always a matter of faith, as I said. Faith is universal, so there is no reason to argue over it without focusing on the underlying motivators of that faith.

To discuss the "why" means to start talking about faith, and to lose sight of the truly important matter of the facts that support it. As our conversations shows, we have focused on the faith, but our discussion only lightly touches upon the basis of that faith. There is no in-depth evaluation of the scientific system, or of evolution or creationism. The mentions are only enough to keep the discussion of "why" running smoothly.

When arguing about evolution vs creationism, it is useless to focus on the faith, because the faith means nothing without the "what" of the matter. Unless you break down the reasons behind the faith in detail and attempt to prove or disprove them within the boundaries of a paradigm, then you are going nowhere.

On the flipside, a discussion of faith is not necessary to the "what" of the argument because of it's universal nature.


"what" "why" "what" "when" "why" "where" "what" "how" "where" "AHHH IT'S RIGHT BEHIND ME!" *dies*

brokk
August 2nd, 2005, 02:42 PM
You forgot about "who"! And you posted "what" like 3 times. Does that have anything to do with the weird way in which articles are used in german? hehe, "das" : P

Ist das das Telefone? (How can you use the same word for two different things!? What sort of language is this?)
Nein, das ist nicht das Telefon. Das ist die... Briefmarke err something.

So much for my german, I am trying to learn german on my own with books and online resources.

To discuss the "why" means to start talking about faith, and to lose sight of the truly important matter of the facts that support it. As our conversations shows, we have focused on the faith, but our discussion only lightly touches upon the basis of that faith. There is no in-depth evaluation of the scientific system, or of evolution or creationism. The mentions are only enough to keep the discussion of "why" running smoothly.

When arguing about evolution vs creationism, it is useless to focus on the faith, because the faith means nothing without the "what" of the matter. Unless you break down the reasons behind the faith in detail and attempt to prove or disprove them within the boundaries of a paradigm, then you are going nowhere.
I see your point. Can't add much more to this, so I guess the general discussion will continue from now.

dfacto
August 2nd, 2005, 03:03 PM
I'm actually a US citizen. :P It's just a bit tricky to write a fast post when using so many whats and whys and shit. But my English probably has been corrupted by the crazy German grammar. >.<

Mr. Visions
August 3rd, 2005, 04:32 AM
Seeing that many of the spiteful shall remain spiteful, I leave this thread with a quote that you can take to the bank...

Romans 9:19-21Φ

19 One of you will say to me: "Then why does God still blame us? For who resists his will?" 20But who are you, O man, to talk back to God? "Shall what is formed say to him who formed it, 'Why did you make me like this?' "[a] 21Does not the potter have the right to make out of the same lump of clay some pottery for noble purposes and some for common use?

- Visions (leaves the thread, hoping that those who are so eager to disprove the Bible and it's authority will learn one day not to be so skeptical of good moral teachings and putting down other people's faith that offers answers and hope in peoples lives, no matter how lowly they may think of them...

Just as soon as you can prove that there could be a God, you'll get all the converts.

Unfortunately, there are so many gullible, uneducated, and needy people on this planet that you don't even need to. Bummer.)

One more thing. Science is a useful and highly reliable tool for mankind to use. But, it is developed by man, and man has been known to make his/her mistakes.

God bless all you guys and I pray for you all. We're all part of this great community here at conceptart, and I'm thankful to work with everyone here. I won't put down anyone here, because that would be alittle hypocritical on my part if I'm claiming to be what I am. I don't set out to argue with anyone, I just presented the truth that has proven itself over and over and over again in my personal life, and I'm sharing those things with you guys, which I have the right to do, as do you. So, I have done so. Take care everyone. I wish you the best.

wassermelone
August 3rd, 2005, 04:57 AM
Seeing that many of the spiteful shall remain spiteful, I leave this thread with a quote that you can take to the bank...

Romans 9:19-21Φ

19 One of you will say to me: "Then why does God still blame us? For who resists his will?" 20But who are you, O man, to talk back to God? "Shall what is formed say to him who formed it, 'Why did you make me like this?' "[a] 21Does not the potter have the right to make out of the same lump of clay some pottery for noble purposes and some for common use?

- Visions (leaves the thread, hoping that those who are so eager to disprove the Bible and it's authority will learn one day not to be so skeptical of good moral teachings and putting down other people's faith that offers answers and hope in peoples lives, no matter how lowly they may think of them...

That is not what is in dispute in this thread. But since you brought it up, I wish religious people would stop abjectly applying their own theology to me. Its kind of hard to be horrendously nice when the person talking to you fully believes (but never says) that you will be burning in hell for all eternity because (no matter how nice one is) for doing something as silly as saying that there are no invisible pink unicorns that are eternally forgiving and kind. Hows that for putting down other people's faith or beliefs? Its that pitying look in your eyes that really says how they feel no matter how many times they say "I love everyone."

One more thing. Science is a useful and highly reliable tool for mankind to use. But, it is developed by man, and man has been known to make his/her mistakes.


Yeah like religion.

You might notice you hit a nerve.

dfacto
August 3rd, 2005, 07:05 AM
Insulting someone, condescending to them, it's all the same. Either way you are expressing your perceived superiority and questioning theirs. Welcome to the party.

stoph
August 3rd, 2005, 08:38 AM
sorry to be anticlimatical, my priorities need a reality check here. im cashing in my chips too. sorry, i just cant afford the time anymore (not to mention being away for like the past 2 pages.. doubt i can catch up :\) . been great talking with you all, hope to see you elsewhere in the forum sometime!

- 'stoph.

wassermelone
August 3rd, 2005, 09:20 AM
Insulting someone, condescending to them, it's all the same. Either way you are expressing your perceived superiority and questioning theirs. Welcome to the party.

Woo. I fully agree.

But I was never under the pretenses that I wasn't part of that party.

dfacto
August 3rd, 2005, 09:45 AM
Well, it was a reply meant for visions, but it does have broader applications. :P

I know I fall under it.

And Stoph, you don't need to take a ton of time, but I would like to know what exactly bothers you about the idea of genetic complexity through mutation.